SequenceSiftR: SequenceSiftR

In brengong/ConservationtextmineR:

Description

Requires a data.table with a column labeled "Sequence"

Usage

SequenceSiftR(DT, Percent, output)

Arguments

DT	a data table containing a column labeled "Sequence" housing the DNA sequences to analyze.
Percent	a numerical value between 0 and 1 indicating the percentage of "N"'s in the DNA sequence.
output	a logical character either "return", "remove", or"return_remove". If "return" will add an additional column to the data table indicating the percentage of "N"'s in the DNA string. If "remove", will return the data table after removing the rows containing sequences that have a greater number of "N"'s than the specified "Percent" cutoff. If "return_remove" will add an additional column to the data table indicating the percentage of "N"'s in the DNA string and return the data table after removing the rows containing sequences that have a greater number of "N"'s than the specified "Percent" cutoff.

Value

The data table as specified by the output argument.

Author(s)

Brendan Gongol

Examples

Sequence <- c("AAGCTAAGCTAAGCTGCGCAATTTTTGTATTTTGTTTAAACAGAATCCTCAAGGGAACATCATCCTCAGTTCTTTTTGTGTATTAGCTCAGATTTTCCAGCTGTTTTTAAAGCT",
              "CTGTTTCGAGCCTGAATCTCGATCGCTCGCGCTAGACAGCTCGACGCACTTTTCAGCAGGAGCCTG",
              "TCAGCAGATAGCGCTCGATACAGCTCGACAGCTCTTGCTGTATTGTGTG",
              "TTGCTGTATTGTGTGATCCTCGATACAGGTATTTTCTGAGCCTGATAGCTAGCTTTGCTGTATTGTGTG",
              "AAAAAATTTTTTCCCCCCGGGGGG", "NNTGCTAGCNNNACATCGCTACNNCTAGATCGAT", "NNNNNNAGCTNNNNNNAGCTGNNNNNACNNNNN", "NNNNNNNNNANNNNNNNNNTNNNNNNNNNC")
gene_symbol <- c("AKT", "PI3K", "SREBP", "FOXO", "ABCA1", "Caspase-1", "PIGPEN", "SNAIL")
chromosome_name <- c("1", "5", "10", "X", "Y", "2", "3", "4")
chromo <- data.frame(cbind(Sequence, gene_symbol, chromosome_name))
chromo$Sequence <- as.character(chromo$Sequence)
chromo$chromosome_name <- as.character(chromo$chromosome_name)
chromo

SequenceSiftR(chromo, output = "return")
SequenceSiftR(chromo, Percent = 0.49, output = "remove")
SequenceSiftR(chromo, Percent = 0.49, output = "return_remove")

brengong/ConservationtextmineR documentation built on July 29, 2019, 10:05 a.m.