runLayerBinding: Run the layer binding simulation

In davetgerrard/GenomicLayers: Simple, sequence-based simulation of epi-genomes.

Run the layer binding simulation

Description

Description text here

Usage

runLayerBinding(
  layerList,
  factorSet,
  iterations = 1,
  bindingFactorFreqs = rep(1, length(factorSet)),
  watch.function = function(x) {
 },
  collect.stats = FALSE,
  target.layer = 2,
  verbose = FALSE,
  ...
)

Arguments

layerList	a "Layerlist" object containing a layerSet and other meta-data
factorSet	a "list" of "bindingFactor" objects
iterations	how many changes to make NEED TO RENAME THIS
bindingFactorFreqs	the relative proportions of each "bindingFactor" in "factorSet"
watch.function	have this function execute during each iteration e.g. print something
collect.stats	collect a table of stats each iteration
target.layer	NOT IMPLEMENTED
verbose	give more output

Value

A list containing a "LayerSet" and meta-data, a.k.a. a "LayerList"

See Also

runLayerBinding.BSgenome matchBindingFactor modifyLayerByBindingFactor.Views

Examples

require(Biostrings)     # hopefully this should be available?!

basicLayerList <- createLayerList.DNAstring(seq=DNAString("ACGTTGAAGT"), layerNames=c( "LAYER.1"))

simpleBindingFactor <- createBindingFactor.layer_region(name="simpleBF")

runLayerBinding(basicLayerList, factorSet= list(simpleBF = simpleBindingFactor))  # not working.

# The above find a match to a single DNA pattern in the sequence and is not different from using matchPattern()
# Here, we model two layers on the sequence and a second binding factor that only responds to changes 
# that have already been made to LAYER.1

twoLayerList <- createLayerList.DNAstring(seq=DNAString("ACGTTGCCATAAACGTTGCCATAAGTGT"), 
               layerNames=c( "LAYER.1", "LAYER.2"))

bfList <- list( DNA_A = createBindingFactor.DNA_motif(name="DNA_A",patternString = "CAT" ) ,
                LAYER_1_2 = createBindingFactor.layer_region(name="LAYER_1_2", 
                                                             profile.layers =c("LAYER.1"), profile.marks = c(1), 
                                                             mod.layers = c("LAYER.2"), mod.marks = c(1)) )



runLayerBinding(twoLayerList, factorSet= bfList)  
runLayerBinding(twoLayerList, factorSet= rev(bfList))     # should not produce hits on LAYER.2

davetgerrard/GenomicLayers documentation built on Nov. 21, 2024, 6:21 a.m.