getMethContext: Get Methylation Context from a chromosome DNA sequence

Description Usage Arguments Value Examples

View source: R/getMethContext.R

Description

This function retrieves the methylation context from a chromosome DNA sequence in fasta format.

Usage

1
getMethContext(chr.seq, chromosome, verbose = TRUE)

Arguments

chr.seq

DNA sequence from a chromosome in fasta format.

chromosome

Chromosome name.

verbose

If TRUE, prints the function log to stdout

Value

GRanges object with three columns: 'trinucleotide', methylation context, and 'CHH' methylation subcontexts: 'CHA', 'CHC', and 'CHT'.

Examples

1
2
3
dna <- Biostrings::DNAString(x = "CCCTAACGACCCTAACGCTACCCTAAACCTCTGAAT",
    start = 1, nchar = NA)
getMethContext(chr.seq = dna, chromosome = "1", verbose = TRUE)

genomaths/MethylIT.utils documentation built on Nov. 26, 2019, 2:10 a.m.