View source: R/getMethContext.R
getMethContext | R Documentation |
This function retrieves the methylation context from a chromosome DNA sequence in fasta format.
getMethContext(chr.seq, chromosome, verbose = TRUE)
chr.seq |
DNA sequence from a chromosome in fasta format. |
chromosome |
Chromosome name. |
verbose |
If TRUE, prints the function log to stdout |
GRanges object with three columns: 'trinucleotide', methylation context, and 'CHH' methylation subcontexts: 'CHA', 'CHC', and 'CHT'.
dna <- Biostrings::DNAString(x = 'CCCTAACGACCCTAACGCTACCCTAAACCTCTGAAT',
start = 1, nchar = NA)
getMethContext(chr.seq = dna, chromosome = '1', verbose = TRUE)
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.