#' @rdname getMethContext
#' @title Get Methylation Context from a chromosome DNA sequence
#' @description This function retrieves the methylation context from a
#' chromosome DNA sequence in fasta format.
#' @param chr.seq DNA sequence from a chromosome in fasta format.
#' @param chromosome Chromosome name.
#' @param verbose If TRUE, prints the function log to stdout
#' @return GRanges object with three columns: 'trinucleotide', methylation
#' context, and 'CHH' methylation subcontexts: 'CHA', 'CHC', and 'CHT'.
#'
#' @examples
#' dna <- Biostrings::DNAString(x = "CCCTAACGACCCTAACGCTACCCTAAACCTCTGAAT",
#' start = 1, nchar = NA)
#' getMethContext(chr.seq = dna, chromosome = "1", verbose = TRUE)
#'
#'
#' @importFrom Biostrings complement
#' @importFrom GenomicRanges makeGRangesFromDataFrame
#' @export
#'
getMethContext <- function(chr.seq, chromosome, verbose=TRUE){
base <- strsplit(unname(as.character(chr.seq)), split="")[[1]]
start <- grep("[C]", base)
trinucleotide <- paste0(base[start], base[(start + 1)], base[(start + 2)])
context <- trinucleotide
## ==== Positive strand ===== ##
if (verbose) cat("*** Extracting contexts for the positive strand ...\n")
context[grep("CG", trinucleotide)] <- "CG"
context[grep("C[ABCDEFHIJKLMNOPQRSTUVWXYZ]{1}G", trinucleotide)] <- "CHG"
subcontext <- context
context[grep("C[ABCDEFHIJKLMNOPQRSTUVWXYZ]{1}[ABCDEFHIJKLMNOPQRSTUVWXYZ]{1}",
trinucleotide )] <- "CHH"
subcontext[grep("C[ABCDEFHIJKLMNOPQRSTUVWXYZ]{1}A", trinucleotide)] <- "CHA"
subcontext[grep("C[ABCDEFHIJKLMNOPQRSTUVWXYZ]{1}C", trinucleotide)] <- "CHC"
subcontext[grep("C[ABCDEFHIJKLMNOPQRSTUVWXYZ]{1}T", trinucleotide)] <- "CHT"
subcontext[grep("C[ABCDEFHIJKLMNOPQRSTUVWXYZ]{1}[BDEFHIJKLMNOPQRSUVWXYZ]{1}",
trinucleotide)] <- "CHH"
x.pos <- data.frame(seqnames=chromosome, start=start, end=start,
strand="+", trinucleotide=trinucleotide,
context=context, subcontext=subcontext)
## ==== negative strand ===== ##
if (verbose) cat("*** Extracting contexts for the negative strand ...\n")
chr.seq <- complement(chr.seq)
base <- strsplit(unname(as.character(chr.seq)), split="")[[1]]
start <- grep("[C]", base)
trinucleotide <- paste0(base[start], base[(start - 1)], base[(start - 2)])
context <- trinucleotide
context[grep("CG", trinucleotide)] <- "CG"
context[grep("C[ABCDEFHIJKLMNOPQRSTUVWXYZ]{1}G", trinucleotide)] <- "CHG"
subcontext <- context
context[grep("C[ABCDEFHIJKLMNOPQRSTUVWXYZ]{1}[ABCDEFHIJKLMNOPQRSTUVWXYZ]{1}",
trinucleotide)] <- "CHH"
subcontext[grep("C[ABCDEFHIJKLMNOPQRSTUVWXYZ]{1}A", trinucleotide)] <- "CHA"
subcontext[grep("C[ABCDEFHIJKLMNOPQRSTUVWXYZ]{1}C", trinucleotide)] <- "CHC"
subcontext[grep("C[ABCDEFHIJKLMNOPQRSTUVWXYZ]{1}T", trinucleotide)] <- "CHT"
subcontext[grep("C[ABCDEFHIJKLMNOPQRSTUVWXYZ]{1}[BDEFHIJKLMNOPQRSUVWXYZ]{1}",
trinucleotide)] <- "CHH"
x.neg <- data.frame(seqnames=chromosome, start=start, end=start, strand="-",
trinucleotide=trinucleotide, context=context, subcontext=subcontext)
x <- rbind(x.pos, x.neg)
x <- makeGRangesFromDataFrame(x, keep.extra.columns=TRUE)
return(sortBySeqnameAndStart(x))
}
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.