knitr::opts_chunk$set(fig.width=12, fig.height=8, fig.path='Figs/', eval = FALSE, warning=FALSE, message=FALSE)
The sample sheet sheet should have 4 columns, and describes the layout of your experiment. The first column gives the names of the files containing the guide counts. The second column gives the name of sample. The third and fourth columns define the treatment and replicate status. For the treatment status, we recommend using 0 to indicate the initial condition, and 1 to represent the later observation. This ensures that any changes reported by the subsequent analysis are relative to the initial observations. An example of a sample sheet is given here:
File Sample Treatment Replicate GeCKOv2_1A_count.txt C111 0 1 GeCKOv2_1B_count.txt C111 0 1 GeCKOv2_2A_count.txt C111 1 1 GeCKOv2_2B_count.txt C111 1 1 GeCKOv2_1Ar_count.txt C111 0 2 GeCKOv2_1Br_count.txt C111 0 2 GeCKOv2_2Ar_count.txt C111 1 2 GeCKOv2_2Br_count.txt C111 1 2
For the moment, the sample sheet should be saved as a tab delimited text file. In the future we may add support for other formats, including Excel spread sheets, but this is not currently available.
The first step in an analysis is to load the library like this:
library(MEMcrispR)
This step can be performed using any tool of your choice, but MEMcrispR provides an option to do this via the Rsubread package, using the function memcrispr.align().
There are a number of arguments that you need to provide to this function: path defines the location of the folder containing the FASTQ files, and sampleSheet is the name of the sample sheet file, which should meet the structure defined earlier. outputDir gives the location where the function should output the aligned bam files.
The next argument is guideLibraries which allows you to specify the set of guide RNAs your reads should be aligned against. Currently MEMcrispR contains details for the GeCKOv2 and TKO CRISPR libraries, and you can choose any combination from GeCKOv2_A, GeCKOv2_B, TKOv1_base and TKOv2_supp. It is advisable to pick to the minimum selection that may still be possible e.g. if you used the GeCKO kit do not select TKOv1... as this will cause the alignment step to take longer than necessary. It is also possible to provide details of other libraries that are not distributed with the package; this is discussed in the next section.
Finally, we can use the guidePrefix and guideSuffix arguments to provide details of flanking sequences that surround the specific guide sequence and are common to all reads in the dataset. Note: these used to be hard-coded for the GeCKO data, but you must provide them now we work with more libraries.
This function will create a SampleSheet.txt in the output directory, which can be used with the next function in our analysis meaning you do not need to create this each time.
memcrispr.align(path = "/g/korbel/shared/projects/crispr_screens/soft_agar/mcf10a/raw_data/", sampleSheet = "SampleSheet.txt", outputDir = "/g/korbel/shared/projects/crispr_screens/soft_agar/mcf10a/aligned/", guideLibraries = c("GeCKOv2_A", "GeCKOv2_B"), guidePrefix = "NNNNCTTGTGGAAAGGACGAAACACCG", guideSuffix = "GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCAC")
If MEMcrispR doesn't include details of the CRISPR library that you are using, you can provide details of the guides manually. To do this you can provide the guideLibraries argument with the location of one or more files detailing the guides in your library. These files are required to be text files with four columns and one row per guide. For each guide the columns give the ID of the targeted gene, a unique ID for the guide, the guide sequence, and a name for the library, with columns named gene_id, guide_id, seq, library respectively. An example might look something like this:
gene_id guide_id seq library A1CF sgA1CF_1 ATGACTCTCATACTCCACGA KOHGW-M1 A1CF sgA1CF_2 CGCGCACTGGTCCAGCGCAC KOHGW-M1 A1CF sgA1CF_3 CCAAGCTATATCCTGTGCGC KOHGW-M1 A3GALT2 sgA3GALT2_1 CGAATGCGCGTCGCGTTCGA KOHGW-M1 A3GALT2 sgA3GALT2_2 CTTCGAACGCGACGCGCATT KOHGW-M1 A3GALT2 sgA3GALT2_3 CGGCAGATCCTACTTACACT KOHGW-M1
An example of providing them to the memcrispr.align() function might look something like the code below. NOTE: this actual example will perform badly, as it will align reads to the wrong guide library.
memcrispr.align(path = "/g/korbel/shared/projects/crispr_screens/soft_agar/mcf10a/raw_data/", sampleSheet = "SampleSheet.txt", outputDir = "/tmpdata/msmith/aligned", guideLibraries = c("/g/korbel/shared/projects/crispr_screens/balca_libraries/balca_lib_M1.csv", "/g/korbel/shared/projects/crispr_screens/balca_libraries/balca_lib_M2.csv"), guidePrefix = NULL, guideSuffix = "GTTTAAGAGCTATGCTGGAAACAGCATAGC")
After alignment we need to count how many reads aligned to each guide sequence. This is simlar to using samtools idxstat if you're using an external program. MEMcrispR performs this using the function memcrispr.count(). Many of the arguments are the same as seen above, but not that this time path is the location of the aligned BAM files, and outputDir is the location where the table of counts should be created.
This function will again create a SampleSheet.txt that can be directly used with the next function in our analysis.
memcrispr.count(path = "/g/korbel/shared/projects/crispr_screens/soft_agar/mcf10a/aligned", sampleSheet = "SampleSheet.txt", outputDir = "/g/korbel/shared/projects/crispr_screens/soft_agar/mcf10a/counts", guideLibraries = c("GeCKOv2_A", "GeCKOv2_B"))
Once you've performed the alignement and guide counting we're ready to read the count data. This is performed using the function memcrispr.readCounts(), which takes two arguments. One of these is the name of the sample sheet file, and the other is the path where the sample sheet and read count files can be found.
guideCounts <- memcrispr.readCounts(sampleSheet = "SampleSheet.txt", path = "/g/korbel/shared/projects/crispr_screens/soft_agar/c93/counts")
The resulting object is essentially a large table containing the counts for all guides in the experiment and the gene they target, along with the meta-data listed in the sample sheet such as the sample name, treatment and replicate status.
guideCounts
Given the nature of sequencing experiments, it is likely that there will be differences the total number of reads generated for the various conditions and replicates. If we work with the raw counts, there is a chance that any trends we find in the data reflect the technical differences in read-depth, rather than anything biological. In order to reduce the impact of these differences we can use the function normalizeBetweenSamples() to adjust the counts and bring the various samples in line with each other.
guideCounts <- memcrispr.normalizeBetweenSamples(guideCounts)
There are a number of statistics we can look at to evaluate the quality of the sequencing data.
For example, we can assess the distribution of reads across the guides, and compare this across libraries and repicates using the function guideDistributions(). You can use this to evaluate whether you need to perform the between sample normalisation mentioned previously. If you have already carried out the normalisation guideDistributions() will display the distributions of both the raw and normalised counts, as in the example below:
memcrispr.guideDistribution(guideCounts)
If you have replicates of each condition (and you should have replicates) we can compare the counts of control guides using the function memcrispr.compareControlGuides(). By default this will try to compare the counts for all guides across the replicates, not just the controls. This can be very slow, so we can use the argument controlString to specify a pattern in the guide names that we should use to select the controls. For the GeCKO libraries the control guides all contain the word 'control', but this be different for different CRIPR libraries. If you have more than two replicates this function will show each compared to all the rest e.g. in the case of 3 replicates: rep1 vs rep2, rep1 vs rep3 & rep2 vs rep3.
memcrispr.compareControlGuides(guideCounts, controlString = "control")
Ideally the control counts will lie along the diagonal line and the correlation reported in the upper right half of the plots will be close to 1, indicating that the controls have performed similarly across the two replicates. If this is not the case, then you may have cause to believe one (or more) of the replicates was not successful.
The model can be fitted using the function memcrispr.fitModel(). This calculates
topTable <- memcrispr.fitModel(guideCounts)
load("/g/huber/users/msmith/geckoR/toptable.rda")
To improve the speed of the model fitting step, you can also try a multicore approach. This splits the table of counts into several pieces and computes on them in parallel, making use of the fact most computers can carry out several tasks simultaneously. This is purely a means to speed up the computation, and the results should be identical to if you use the fitModel() function above.
In order to use this approach you will need to install the multidplyr package. This is currently not available on CRAN, but can be installed from github using the code below. You will only need to do this step the first time you try to run the multicore model fitting, after that the package will be be installed and available.
devtools::install_github("tidyverse/multidplyr")
Since mutlidplyr is not in CRAN, support for this is to be considered experimental, although I have had no problems running it in practice. You can execute the multicore model fit in a very similar fashion to before, just this time using the fitModel.mc() function.
topTable2 <- memcrispr.fitModel.mc(guideCounts, ncores = 4)
memcrispr.volcanoPlot(topTable, p.thresh = 0.05, fc.thresh = 1)
interactionEffects <- memcrispr.fitModel.sampleSpecific(guideCounts, controlString = "control")
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.