R/makeSeq.R

In hyginn/rptPlus: R Package Template - Enhanced

# makeSeq.R

#' \code{makeSeq} output a random DNA sequence.
#'
#' \code{makeSeq} outputs a string that contains a random sequence of characters
#' (A/C/G/T by default). By default the first three letters are "ATG" and the
#' last three letters are a stop-codon ("TAA", "TAG" or "TGA"). The number of
#' characters in the output is three times the \code{len} argument, i.e. it
#' contains \code{len} codons. Note: the function does not \code{set.seed()};
#' according to current best-practice, functions should never change the state
#' of the RNG since this is a global change. Instead, execute \code{set.seed()}
#' with a parameter of your choice before the function call if you wish the
#' sequence to be reproducible.
#'
#' @param len (integer)       number of codons in the returned string
#' @param useInit  (logical)  make the first codon an initiation codon. Default
#'                            is \code{TRUE}.
#' @param useStop  (logical)  make the last codon a stop codon. Default is
#'                            \code{TRUE}.
#' @param alphabet (character vector)  the elements that are randomly
#'                                     concatenated. Default is A/C/G/T.
#' @param p (numeric vector)  Probabilites for each character to occur. Default
#'                            is equiprobable.
#' @return (character) a single string
#' @import Biostrings
#' @examples
#' makeSeq(7)  # six amino acids (incl. start codon) and a stop codon
#' \dontrun{
#'   set.seed(112358)  # reproducible random
#'   makeSeq(7, p = c(0.2, 0.4, 0.4, 0.2))  # "ATGTATTTGTACCGGCGTTAA"
#'   set.seed(NULL)
#' }
#' gsub("T", "U", makeSeq(7)) # for RNA
#' @export
makeSeq <- function(len,
                    useInit = TRUE,
                    useStop = TRUE,
                    alphabet = c("A", "C", "G", "T"),
                    p = rep(0.25, 4)) {

  if (useInit) {
    myInit <- "ATG"
    len <- len - 1
  } else {
    myInit <- NULL
  }

  if (useStop) {
    myStop <- sample(c("TAA", "TAG", "TGA"), 1)
    len <- len - 1
  } else {
    myStop <- NULL
  }

  v <- c(myInit,
         sample(alphabet, len * 3, prob = p, replace = TRUE),
         myStop)

  return(paste(v, collapse = ""))
}

# [END]