#' Check Docker
#'
#' Check if Docker API is available
#'
is_docker_available <- function(opt) {
docker_available <- Sys.which("docker")
if (isTRUE(docker_available != "")) {
opt$docker <- TRUE
} else {
opt$docker <- FALSE
}
opt
}
#' Development Parameters
#'
#' Assign parameters for interactive testing during development
#'
#' @param opt
assign_test <- function(opt) {
#Sys.setenv(PATH = paste("/edirect:/VelvetOptimiser-2.2.6:/CAP3",Sys.getenv("PATH"),sep = ":"))
#Sys.getenv("PATH")
#setwd("/temp_files/")
#getwd()
opt$fasta <- TRUE
opt$input <- fs::path("library", "ERR555102.trimmed.fasta")
opt$ref <- fs::path("reference_genome", "ixodes_scapularis-W1.fa")
opt$bact <- fs::path("bacterial_genomes", "all_bacters.fasta")
opt$nr <- fs::path("blast_nr", "nr")
opt$nt <- fs::path("blast_nt", "nt")
opt$adapter <- "TGGAATTCTCGGGTGCCAAGGAACTCCAGT"
opt$threads <- "10"
opt$si <- "21"
opt$se <- "24"
opt$hash <- "15"
opt$deg <- TRUE
opt$output <- base::paste0("five_results-", base::format(base::Sys.time(), "%Y%m%d"))
opt$plot <- FALSE
opt$sra <- FALSE
opt
}
#' Function to print list based options as data frame
print_opt <- function(opt) {
dplyr::data_frame(
key = names(opt),
value = unlist(opt)
)
}
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.