getPhaseSpectraSingle: Get the Fourier Phase Spectrum for a single encoded Genomic...
In mathornton01/afgencomp: Alignment Free Genetic Comparisons

Description Usage Arguments Value Examples

This function produces the phase spectrum of the Fourier transform for a single genomic signal that has been encoded using either the 2D or 4D representation, the function will produce an error if it is not supplied with a matrix of values that has a number of rows equal to 2 or 4. (AM)

1	getPhaseSpectraSingle(encodedSignal)

encodedSignal

is a genomic signal of interest, for which the average power spectrum will be computed and returned to the user, you may encode your genomic character strings by using the encodeGenomes or encodeGenome function in this package.

A vector of values indicating the average phase spectral density (according to the Fourier Transform) for the encoded genomes four, or two constituent signals.

MTHFR100 <- "TGGCCAGGTATAGTGGCTCATACCTGTAATCCCAGCACTCTGGGAGACCGAAGCAGTATCACCTGAGGTCAGGAGTTCGAGACCAGCCTGGCCAACATG";
encMTHFR100 <- encodeGenome(MTHFR100);
psMTHFR100 <- getPhaseSpectraSingle(encMTHFR100);
plot(psMTHFR100, type='l',xlab='Frequency/Sequency',
     ylab='Phase Spectral Density', main="Phase Spectrum of First 100 nucleotides of MTHFR");