R/afgencomp.R

Defines functions tstForMultiGenomes getMinimalVarianceFilter countFFMersEnsemble countMersCertainFirstFive countKmersCertain getPowerSpectraDistances evenlyScaleEnsemble evenlyScaleSingle getPhaseSpectraEnsemble getPhaseSpectraSingle getPowerSpectraEnsemble getPowerSpectraSingle encodeGenomes getOptimal2DStrategy encodeGenome

Documented in countFFMersEnsemble countKmersCertain countMersCertainFirstFive encodeGenome encodeGenomes evenlyScaleEnsemble evenlyScaleSingle getMinimalVarianceFilter getOptimal2DStrategy getPhaseSpectraEnsemble getPhaseSpectraSingle getPowerSpectraDistances getPowerSpectraEnsemble getPowerSpectraSingle tstForMultiGenomes

################################################################################
#  Alignment Free Genomic Comparisons (afgencomp)                              #
#  Micah A. Thornton                                                           #
#                                                                              #
#  Version 1.0 (12-14-2021)                                                    #
################################################################################

# The original code below is from a previous version of the afgencomp package
# which was hosted under the name 'YinGenomicDFT'.  The code was captured from
# Github on 12-14-2021, but was originally dated April 2021.  The summary ' A
# Translation of Much of the DFT Distance Framework into an R-Package ' was
# given as the primary purpose of the package was indeed to implement an R
# version of the MatLab package created by Yin and Yau (2021) for the same
# purpose.

################################################################################
#' Encode a Single Genome
#'
#' Encodes a single genomic signal accepted as a character string into either
#' a four by signal length (4 x n), or two by signal length (2 x n) matrix
#' depending on whether
#' the user specifies 2D or 4D, that contains the encoded genomic signal.
#' @param stringGenome The genomic signal the user would like to work with
#' @param dimension Either '2D' or '4D' character vector, '4D' by default, this
#' specifies whether to use the binary four-signal encoding originally described
#' in 2014 by Yin and Yau, or three-vauled two-signal encoding.
#' @param strategy This is only used for the 2D encoding, it determines which of
#' the possible 2D encodings is used, this is determined for ensembles by
#' considering the concentration of nucleotides which are Adonine and Cytosine or
#' Adonine and Guanine.
#' @return Returns a matrix of dimension 2xSignalLength, or 4xSignalLength where
#' each row is determined by the encoding strategy, for 4D encoding, each row
#' represents the presence or absence of a specific nucleotide, for the 2D
#' encoding, the two signals of three values -1, 0, 1 are determined according
#' to the strategy choosen.
#' @examples
#' EncodedSignal2D <- encodeGenome('ACCACTTGAAGAGAGCCCGGGAT', '4D');
#' EncodedSignal4DAC <- encodeGenome('ACCACTTGAAGAGACCCGGGAT', '2D', 'AC');
#' EncodedSignal4DAG <- encodeGenome('ACCACTTGAAGAGACCCGGGAT','2D','AG');
#' @export
encodeGenome <- function(stringGenome,dimension='4D',strategy="AC"){
  if (dimension == "4D"){
    strUpper <- toupper(stringGenome);
    encA <- gsub('A','1', gsub('[^A]', '0',strUpper));
    encC <- gsub('C','1', gsub('[^C]', '0',strUpper));
    encG <- gsub('G','1', gsub('[^G]', '0',strUpper));
    encT <- gsub('T','1', gsub('[^T]', '0',strUpper));
    encodedSignal <- rbind(as.numeric(unlist(strsplit(encA,''))),
                           as.numeric(unlist(strsplit(encC,''))),
                           as.numeric(unlist(strsplit(encG,''))),
                           as.numeric(unlist(strsplit(encT,''))));
    return(encodedSignal);
  }
  if (dimension == "2D"){
    encodedSignal <- matrix(0,nrow=2,ncol=nchar(stringGenome))
    Alocs <- as.vector(gregexpr('A',toupper(stringGenome))[[1]]);
    Clocs <- as.vector(gregexpr('C',toupper(stringGenome))[[1]]);
    Glocs <- as.vector(gregexpr('G',toupper(stringGenome))[[1]]);
    Tlocs <- as.vector(gregexpr('T',toupper(stringGenome))[[1]]);
    if (strategy == "AC"){
      encodedSignal[2,Alocs] <- -1;
      encodedSignal[2,Clocs] <- 1;
      encodedSignal[1,Glocs] <- 1;
      encodedSignal[1,Tlocs] <- -1;
    }
    if (strategy == "AG"){
      encodedSignal[2,Alocs] <- -1;
      encodedSignal[1,Clocs] <- 1;
      encodedSignal[2,Glocs] <- 1;
      encodedSignal[1,Tlocs] <- -1;
    }
    return(encodedSignal)
  }
}

################################################################################
#' Determine Optimal 2D encoding
#'
#' Uses the ensemble of strings provided by the user as a list of genomic
#' signals and determines the optimal encoding strategy by the algorithim
#' proposed in Yin and Yau 2015, where the distance from A,C concentration
#' and A,G concentration to one-half are used to determine which encoding will
#' provide the best balance among all the possible encodings.
#' @param stringGenomes A list of strings representing genomic signals
#' @return A character vector containing the name of the optimal strategy, either
#' 'AC' or 'AG'.
#' @examples
#' getOptimal2DStrategy(list('ACCCTTAACCAAGGAGGGAGAGTTTCCCCGGGGGAGG',
#'                            'CCCCCCACACAAACCCTTGGGGAAAACCCGGAAGGCCCCCC'));
#' @export
getOptimal2DStrategy <- function(stringGenomes){
  total <- 0;
  AC <- 0;
  AG <- 0;
  for (stringGenome in stringGenomes){
    total <- total + nchar(stringGenome);
    AC <- AC + sum(table(strsplit(toupper(stringGenome),''))[c('A','C')]);
    AG <- AG + sum(table(strsplit(toupper(stringGenome),''))[c('A','G')]);
  }
  Rac <- abs(AC/total - 0.5);
  Rag <- abs(AG/total - 0.5);
  if (Rac <= Rag) {return('AC')}
  else {return('AG')}
}

################################################################################
#' Encode an ensemble of genomes into a numerical form
#'
#' Will produce a list of either the 4D or the 2D representation of a set of
#' signals and return them in a list.
#' @param stringGenomes is a list containing the genomes in a string format
#' @param dimension is a character string either '2D' or '4D'.
#' @return A list containing matrixes of various column length, but either 2 or
#' 4 rows.
#' @examples
#' encodeGenomes(list('ACCCCAATTAGAGGGACTTTGGGAACCGGAGAT','GGCCCAGAGGGAAACCGGT'),
#'               '2D');
#' encodeGenomes(list('ACCCCAATTAGAGGGACTTTGGGAACCGGAGAT','GGCCCAGAGGGAAACCGGT'),
#'               '4D');
#' @export
encodeGenomes <- function(stringGenomes,dimension='2D') {
  if (dimension=='2D'){
    strat <- getOptimal2DStrategy(stringGenomes);
  }
  encodedSignals <- list();
  return(lapply(stringGenomes, function(x){
    return(encodeGenome(x,dimension,strat));
  }))
}

################################################################################
#' Get the Fourier Power Spectrum for a single encoded Genomic Signal
#'
#' This function produces the power spectrum of the Fourier transform for a
#' single genomic signal that has been encoded using either the 2D or 4D
#' representation, the function will produce an error if it is not supplied with
#' a matrix of values that has a number of rows equal to 2 or 4.
#' @param encodedSignal is a genomic signal of interest, for which the average
#' power spectrum will be computed and returned to the user, you may encode
#' your genomic character strings by using the encodeGenomes or encodeGenome
#' function in this package.
#' @return A vector of values indicating the average power spectral density
#' (according to the Fourier Transform) for the encoded genomes four, or two
#' constituent signals.
#' @examples
#' MTHFR100 <- "TGGCCAGGTATAGTGGCTCATACCTGTAATCCCAGCACTCTGGGAGACCGAAGCAGTATCACCTGAGGTCAGGAGTTCGAGACCAGCCTGGCCAACATG";
#' encMTHFR100 <- encodeGenome(MTHFR100);
#' psMTHFR100 <- getPowerSpectraSingle(encMTHFR100);
#' plot(psMTHFR100, type='l',xlab='Frequency/Sequency',
#'      ylab='Power Spectral Density', main="Power Spectrum of First 100 nucleotides of MTHFR");
#' @export
getPowerSpectraSingle <- function(encodedSignal){
  PS <- function(x) {return(abs(x)^2)}
  if (!nrow(encodedSignal) %in% c(2,4)){
    print("Please encode genomic string prior to attempting to get the power spectrum");
    return();
  }
  fc <- t(apply(encodedSignal,1,fft))
  ps <- t(apply(fc,1,PS));
  return(colMeans(ps))
}

################################################################################
#' Get the Fourier Power Spectra for an ensemble of encoded genomic signals
#'
#' This is a wrapper for the getPowerSpectraSingle function, that allows for
#' the direct return of power spectra for each of the signals in an ensemble.
#' @param encodedEnsemble a list of encoded genomes that are produced using
#' one of the encoding methods programmed in this package.
#' @return A list of Power spectra for the corresponding genomic sequences.
#' @examples
#' genStrings1 <- list('ACCAAGGATATTAGGACCC','CCCCAGGGAGATTTAGG','CCCGGGAGAGATTTAG');
#' encStrings1 <- encodeGenomes(genStrings1);
#' psStrings1 <- getPowerSpectraEnsemble(encStrings1);
#' @export
getPowerSpectraEnsemble <- function(encodedEnsemble){
  return(lapply(encodedEnsemble,getPowerSpectraSingle));
}

################################################################################
#' Get the Fourier Phase Spectrum for a single encoded Genomic Signal
#'
#' This function produces the phase spectrum of the Fourier transform for a
#' single genomic signal that has been encoded using either the 2D or 4D
#' representation, the function will produce an error if it is not supplied with
#' a matrix of values that has a number of rows equal to 2 or 4. (AM)
#' @param encodedSignal is a genomic signal of interest, for which the average
#' power spectrum will be computed and returned to the user, you may encode
#' your genomic character strings by using the encodeGenomes or encodeGenome
#' function in this package.
#' @return A vector of values indicating the average phase spectral density
#' (according to the Fourier Transform) for the encoded genomes four, or two
#' constituent signals.
#' @examples
#' MTHFR100 <- "TGGCCAGGTATAGTGGCTCATACCTGTAATCCCAGCACTCTGGGAGACCGAAGCAGTATCACCTGAGGTCAGGAGTTCGAGACCAGCCTGGCCAACATG";
#' encMTHFR100 <- encodeGenome(MTHFR100);
#' psMTHFR100 <- getPhaseSpectraSingle(encMTHFR100);
#' plot(psMTHFR100, type='l',xlab='Frequency/Sequency',
#'      ylab='Phase Spectral Density', main="Phase Spectrum of First 100 nucleotides of MTHFR");
#' @export
getPhaseSpectraSingle <- function(encodedSignal){
  PS <- function(x) {return(atan(Im(x)/Re(x)))}
  if (!nrow(encodedSignal) %in% c(2,4)){
    print("Please encode genomic string prior to attempting to get the phase spectrum");
    return();
  }
  fc <- t(apply(encodedSignal,1,fft))
  ps <- t(apply(fc,1,PS));
  return(colMeans(ps))
}

################################################################################
#' Get the Fourier Phase Spectra for an ensemble of encoded genomic signals
#'
#' This is a wrapper for the getPhaseSpectraSingle function, that allows for
#' the direct return of phase spectra for each of the signals in an ensemble.
#' @param encodedEnsemble a list of encoded genomes that are produced using
#' one of the encoding methods programmed in this package.
#' @return A list of Phase spectra for the corresponding genomic sequences.
#' @examples
#' genStrings1 <- list('ACCAAGGATATTAGGACCC','CCCCAGGGAGATTTAGG','CCCGGGAGAGATTTAG');
#' encStrings1 <- encodeGenomes(genStrings1);
#' psStrings1 <- getPhaseSpectraEnsemble(encStrings1);
#' @export
getPhaseSpectraEnsemble <- function(encodedEnsemble){
  return(lapply(encodedEnsemble,getPhaseSpectraSingle));
}

################################################################################
#' Evenly Scale Signals from their initial size of 'n' to size 'm'.
#'
#' This function will scale a power spectrum from an initial size of n to a
#' size m.  Note that the new signal size m must be larger than the original
#' signal size n, but cannot be too large (larger than twich the original size).
#'
#' @param genomicPS The Power Spectrum of the genetic sequence that is being
#' scaled, in general this could be any arbitrary real sequence, however in
#' keeping with the spirit of the packages overall usability, this function is
#' defined in terms that relate to the genomic nature of the data used.
#' @param scaleTo The length to which it is desired to scale the original
#' spectrum.  This is the same as the value m in the original paper by Yin et
#' al. (2015).
#'
#' @return The scaled power spectrum, which is composed of the original sequence
#' of length n, and is scaled to the new size of m or 'scaleTo'.
#' @examples
#' tg <- "ACCAGGAGATTAGAGCCCCAGAGTAGAGCCCCAGAGATTAGAGCCAGAGTGAGAGCCGANNNAGAGC";
#' pstg <- getPowerSpectraSingle(encodeGenome(tg,'2D'));
#' scaled <- evenlyScaleSingle(pstg,80);
#' @export
evenlyScaleSingle <- function(genomicPS, scaleTo){
  n <- length(genomicPS);
  m <- scaleTo;
  if (m <= n){
    print(paste("Cannot scale sequence (or does not make sense to)
                of size ", n, " to size ", m));
  }
  if (m >= 2*n){
    print("Scaling sequence to more than two times it's original size will
          highly dilute the initial characteristics of the sequence.");
  }
  Tm <- numeric(m);
  Tn <- genomicPS;
  Tm[1] <- Tn[1];
  for (k in 2:m){
    Q <- k*n/m;
    R <- floor(Q);
    if (R == 0){
      R <- 1;
    }
    if (Q-R == 0){
      Tm[k] <- Tn[Q];
    }
    else {
      Tm[k] <- Tn[R] + (Q-R)*(Tn[R+1]-Tn[R]);
    }
  }
  return(Tm);
}

################################################################################
#'  Evenly scale an ensemble of spectra such that their
#'
#'  This function will take an ensemble of genomic power spectra, and scale them
#'  all such that they are of a length equivalent to the maximum length of a
#'  sequence in the ensemble.
#'
#'  @param spectraList A list containing the power spectra of genomic signals
#'  for sequences of interest.
#'
#'  @return A list of scaled spectra all of which should be the same length.
#'
#'  @examples
#'  tg <- c("ACCCAAGAGAGAGCCCCCGAGAGAGAGAGAGAGAGCCCCGAGAGAGCGAGACGAGAC","TAGAGCCGAGATAGAGCCGAGAGTTAGAC","CGGAGAGNNGGAGAGCCCGAGAGTTTGAGNN")
#'  eg <- encodeGenomes(tg);
#'  ps <- getPowerSpectraEnsemble(eg);
#'  sps <- evenlyScaleEnsemble(ps);
#'  @export
evenlyScaleEnsemble <- function(spectraList){
  spectraLengths <- lapply(spectraList,length);
  maxLength <- max(unlist(spectraLengths));
  maxIndex <- which(unlist(lapply(spectraList,length)) == max(unlist(lapply(spectraList,length))));
  scaledSpectra <- list(length(spectraList));
  scaledSpectra[[maxIndex]] <- spectraList[[maxIndex]];
  for (i in 1:length(spectraList)){
    if (i == maxIndex){
      next;
    }
    scaledSpectra[[i]] <- evenlyScaleSingle(spectraList[[i]], maxLength);
  }
  return(scaledSpectra);
}

################################################################################
#' Get the Power Spectra Distance
#'
#' Computes the Euclidean distances among all of the sequences for all of the
#' power spectra, applying a standard Euclidean distance measure to the entire
#' computed spectrum.  The result is returned as a standard pairwise distances
#' matrix.
#' @param genomeList Genetic strings expected in a list.
#' @return pair-wise distances matrix computed as the euclidean distance among
#' the various power spectra for the sequences provided.
#' @examples
#' tg <- c("ACCCAAGAGAGAGCCCCCGAGAGAGAGAGAGAGAGCCCCGAGAGAGCGAGACGAGAC","TAGAGCCGAGATAGAGCCGAGAGTTAGAC","CGGAGAGNNGGAGAGCCCGAGAGTTTGAGNN")
#' dm <- getPowerSpectraDistances(tg);
#' @export
getPowerSpectraDistances <- function(genomeList){
  eg <- encodeGenomes(genomeList);
  ps <- getPowerSpectraEnsemble(eg);
  sps <- evenlyScaleEnsemble(ps);
  dmat <- matrix(0,length(sps),length(sps));
  for (i in 1:length(sps)){
    for (j in i:length(sps)){
      dmat[i,j] <- sqrt(sum((sps[[i]]-sps[[j]])^2))
    }
  }
  return(dmat + t(dmat));
}

################################################################################
#' Get the Kmer Counts for certainty nucleotides (ie remove ambiguous mers)
#'
#' Produces a vector of the counts of all of the kmers in a particular character
#' string representing a genetic sequence.  This implementation will first replace all
#' non-ACGT components with a gapping place holder (-) and will then proceed to
#' count all mers present which do not contain any gaps.
#' @param genomicString A genomic string in the character string format in R
#' @param k The size of the kmers which the user would like to produce a count matrix for
#' @param freq Return the relative proportions of kmers of that kind (default FALSE - return raw counts)
#' @return A vector of kmer counts that contains counts for the kmers in lexicographical
#' ordering.
#' @examples
#' countKmersCertain(sarscvmay[1,]$sequences,5)
#' @export
countKmersCertain <- function(genomicString,k,freq=FALSE){
  kcounts <- numeric(4^k);
  gappedString <- gsub("[^ACGT]","-",toupper(genomicString))
  for (i in 1:(nchar(gappedString)-(k))){
    curmer <- substring(gappedString,i,i+k-1);
    if (grepl("-",curmer,fixed=TRUE)){
      next;
    } else {
      idxConv <- gsub("A","0",curmer);
      idxConv <- gsub("C","1",idxConv);
      idxConv <- gsub("G","2",idxConv);
      idxConv <- gsub("T","3",idxConv);
      meridx <- strtoi(idxConv,4);
      kcounts[meridx+1] <- kcounts[meridx+1]+1;
    }
  }
  if (freq){return(kcounts/sum(kcounts));}
  return(kcounts);
}

################################################################################
#' Compute Vector of counts for first five kinds of kmers
#'
#' Generates a vector of counts (or frequencies) for the first five k-mers (ie.
#' 1-mers, 2-mers, ..., 5-mers) and returns the vector concatenated together.
#' @param genomicString The character string version of the genomic signal which
#' the user wishes to produce the kmer vector for.
#' @param freq Whether the user would like a vector of raw counts back or if
#' a vector of relative frequencies.
#' @return a 1364 length vector containing counts/frequencies for first five mers
#' @examples
#' countMersCertainFirstFive(sarscvmay[1,]$sequences,FALSE)
#' @export
countMersCertainFirstFive <- function(genomicString,freq=FALSE){
  merCount <- c();
  for (i in 1:5){
    merCount <- c(merCount,countKmersCertain(genomicString,i,freq));
  }
  return(merCount);
}

################################################################################
#' Count the first five mers for an ensemble of strings
#'
#' Generates a matrix of size 1364 by number of samples, that will contain
#' counts/frequencies for the first five k-mers for an ensemble of genomic signals.
#' @param genomicStrings A list of character strings representing the genomic signals
#' of interest.
#' @param freq Whether the user would like a vector of raw counts back or if
#' a vector of relative frequencies.
#' @return a 1364 by number of sequences matrix containing the first five mer counts
#' for all of the sequences in "genomicStrings".
#' @examples
#' countFFMersEnsemble(sarscvmay[1:5,]$sequences);
#' @export
countFFMersEnsemble <- function(genomicStrings,freq=FALSE){
  return(matrix(unlist(lapply(genomicStrings,function(x){countMersCertainFirstFive(x,freq)})),
                ncol=length(genomicStrings), byrow=TRUE));
}

################################################################################
#' Filter Highest Variance Components of Power Spectra for Ensemble
#'
#' This function will generate a filter for an ensemble of strings that when
#' multiplied by the power spectra for a sample will push all components with
#' variance (across the ensemble) below the first 'numCoeffs' to zero.
#' @param scaledPowerSpectraEnsemble a list containing the scaled power spectra for
#' an ensemble of strings such as that returned by the function evenlyScaleEnsemble.
#' @param numCoeffs The number of coefficients that the user wishes to use for the
#' distance calculation, this pushes all others to zero.
#' @return a vector of the same length as the input scaled signal length which
#' contains ones in the positions where coefficients have a high across ensemble
#' variance, and zero for those below the desired number of ooefficients.
#' @examples
#' en <- encodeGenomes(sarscvmay[1:5,]);
#' ps <- getPowerSpectraEnsemble(en);
#' sps <- evenlyScaleEnsemble(ps);
#' fil <- getMinimalVarianceFilter(sps,100);
#' @export
getMinimalVarianceFilter <- function(scaledPowerSpectraEnsemble,numCoeffs){
  spsmat <- matrix(unlist(scaledPowerSpectraEnsemble), nrow=length(scaledPowerSpectraEnsemble),
                   byrow=FALSE)
  coeffs <- order(apply(spsmat,2,var),decreasing=TRUE)[1:numCoeffs];
  filt <- numeric(length(scaledPowerSpectraEnsemble[[1]]));
  filt[coeffs] <- 1;
  return(filt);
}

################################################################################
#'  Test Fourier Power spectra computation with random sequences
#'
#'  A function for performing a test of the procedures in this package with randomly
#'  generated genetic strings.
#'  @param numStrings the number of genomic signals to generate
#'  @param avLength the average length of the genomic signals (generated according to Normal Distribution)
#'  @param deviation the variance of the normal distribution with which to compute the vector of lengths.
#'  @return Nothing
#'  @examples
#'  tstForMultiGenomes(100,30000,30)
#'  @export
tstForMultiGenomes <- function(numStrings = 100, avLength, deviation){
  genomeStrings <- list(numStrings);
  lengths <- round(rnorm(numStrings,avLength,deviation));
  for (i in 1:numStrings){
    genomeStrings[i] <- paste(sample(c('A','C','G','T'),lengths[i],replace=T),sep='',collapse='')
  }
  dmat <- getPowerSpectraDistances(genomeStrings);
  print(dmat);
}
mathornton01/afgencomp documentation built on Dec. 21, 2021, 2:52 p.m.