Description Usage Arguments Value Examples
Plots a distribution of given sequence fragment across the whole sequence
1 | plot_kmer_distribution(x, kmer)
|
x |
DNAString object |
kmer |
- string |
plot with distribution of given kmer across sequence
1 | plot_kmer_distribution(Biostrings::DNAString("CAGCTAGCTAGCTAGGCAGCTAGCTAGCTAGCATGCTAGCTAGCTAGCTACGTACGTAGCTACACTAGCTAGCTAGCTAGCTAATAATTATGGCGCGC"),"TAC")
|
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.