knitr::opts_chunk$set(
  message = FALSE,
  error = FALSE,
  warn = FALSE,
  collapse = TRUE,
  comment = "#>"
)
library(data.table)
library(ggplot2)
library(CellBarcode)

Introduction

About the package

What's this package used for?

Cellular DNA barcoding (genetic lineage tracing) is a powerful tool for lineage tracing and clonal tracking studies. This package provides a toolbox for DNA barcode analysis, from extraction from fastq files to barcode error correction and quantification.

What types of barcode can this package handle?

The package can handle all kinds of barcodes, as long as the barcodes have a pattern which can be matched by a regular expression, and each barcode is within a single sequencing read. It can handle barcodes with flexible length, and barcodes with UMI (unique molecular identifier).

This tool can also be used for the pre-processing part of amplicon data analysis such as CRISPR gRNA screening, immune repertoire sequencing and meta genome data.

What can the package do?

The package provides functions for 1). Sequence quality control and filtering, 2). Barcode (and UMI) extraction from sequencing reads, 3). Sample and barcode management with metadata, 4). Barcode filtering.

About function naming

Most of the functions in this packages have names with bc_ as initiation. We hope it can facilitate the syntax auto-complement function of IDE (integrated development toolkit) or IDE-like tools such as RStudio, R-NVIM (in VIM), and ESS (in Emacs). By typing bc_ you can have a list of suggested functions, then you can pick the function you need from the list.

TODO: the function brain-map

About test data set

The test data set in this package can be accessed by

system.file("extdata", "mef_test_data", package="CellBarcode")

The data are from Jos et. al (TODO: citation). There are 7 mouse embryo fibroblast (MEF) lines with different DNA barcodes. The barcodes are in vivo inducible VDJ barcodes (TODO: add citation when have). These MEF lines were mixed in a ratio of 1:2:4:8:16:32:64.

| sequence | clone size 2^x | | --- | --- | | AAGTCCAGTTCTACTATCGTAGCTACTA | 1 | | AAGTCCAGTATCGTTACGCTACTA | 2 | | AAGTCCAGTCTACTATCGTTACGACAGCTACTA | 3 | | AAGTCCAGTTCTACTATCGTTACGAGCTACTA | 4 | | AAGTCCATCGTAGCTACTA | 5 | | AAGTCCAGTACTGTAGCTACTA | 6 | | AAGTCCAGTACTATCGTACTA | 7 |

Then 5 pools of 196 to 50000 cells were prepared from the MEF lines mixture. For each pool 2 technical replicates (NGS libraries) were prepared and sequenced, finally resulting in 10 samples.

| sample name | cell number | replication | | --- | --- | --- | | 195_mixa | 195 | mixa | | 195_mixb | 195 | mixb | | 781_mixa | 781 | mixa | | 781_mixb | 781 | mixb | | 3125_mixa | 3125 | mixa | | 3125_mixb | 3125 | mixb | | 12500_mixa | 12500 | mixa | | 12500_mixb | 12500 | mixb | | 50000_mixa | 50000 | mixa | | 50000_mixb | 50000 | mixb |

The original FASTQ files are relatively large, so only 2000 reads for each sample have been randomly sampled as a test set here.

example_data <- system.file("extdata", "mef_test_data", package = "CellBarcode")
fq_files <- dir(example_data, "fastq.gz", full=TRUE)

# prepare metadata for the samples
metadata <- stringr::str_split_fixed(basename(fq_files), "_", 10)[, c(4, 6)]
metadata <- as.data.frame(metadata)
sample_name <- apply(metadata, 1, paste, collapse = "_")
colnames(metadata) = c("cell_number", "replication")
# metadata should has the row names consistent to the sample names
rownames(metadata) = sample_name
metadata

Installation

Install from Bioconductor.

if(!requireNamespace("BiocManager", quietly = TRUE))
    install.packages("BiocManager")
BiocManager::install("CellBarcode")

Install the development version from Github.

# install.packages("remotes")
remotes::install_github("wenjie1991/CellBarcode")

A basic workflow

Here is an example of a basic workflow:

# install.packages("stringr")
library(CellBarcode)
library(magrittr)

# The example data is the mix of MEF lines with known barcodes
# 2000 reads for each file have been sampled for this test dataset
# extract UMI barcode with regular expression
bc_obj <- bc_extract(
  fq_files,  # fastq file
  pattern = "([ACGT]{12})CTCGAGGTCATCGAAGTATC([ACGT]+)CCGTAGCAAGCTCGAGAGTAGACCTACT", 
  pattern_type = c("UMI" = 1, "barcode" = 2),
  sample_name = sample_name,
  metadata = metadata
)
bc_obj

# sample subset operation, select technical repeats 'mixa'
bc_sub = bc_subset(bc_obj, sample=replication == "mixa")
bc_sub 

# filter the barcode, UMI barcode amplicon >= 2 & UMI counts >= 2
bc_sub <- bc_cure_umi(bc_sub, depth = 2) %>% bc_cure_depth(depth = 2)

# select barcodes with a white list
bc_2df(bc_sub)
bc_sub[c("AAGTCCAGTACTATCGTACTA", "AAGTCCAGTACTGTAGCTACTA"), ]

# export the barcode counts to data.frame
head(bc_2df(bc_sub))

# export the barcode counts to matrix
head(bc_2matrix(bc_sub))

Sequence quality control

Evaluation

In a full analysis starting from fastq files, the first step is to check the seqencing quality and filter as required. The bc_seq_qc function is for checking the sequencing quality. If multiple samples are input the output is a BarcodeQcSet object, otherwise a BarcodeQC object will be returned. In addition, bc_seq_qc also can handle the ShortReadQ, DNAStringSet and other data types.

qc_noFilter <- bc_seq_qc(fq_files)
qc_noFilter
bc_names(qc_noFilter)
class(qc_noFilter)

The bc_plot_seqQc function can be invoked with a BarcodeQcSet as argument, and the output is a QC summary with two panels. The first shows the ratio of ATCG bases for each sequencing cycle with one sample per row; this allows the user to, for example, identify constant or random parts of the sequencing read. The second figure shows the average sequencing quality index of each cycle (base).

For the test set, the first 12 bases are UMI, which are random. This is followed by the constant region of the barcode (the PCR primer selects reads with this sequence), and here we observe a specific base for each cycle across all the samples.

bc_plot_seqQc(qc_noFilter) 

We can also plot one of the BarcodeQc in the BarcodeQcSet object. In the output, there are three panels. The top left one shows the reads depth distribution, the top right figure shows the "ATCG" base ratio by each sequencing cycle, and the last one shows the sequencing quality by sequencing cycle.

qc_noFilter[1]
class(qc_noFilter[1])
bc_plot_seqQc(qc_noFilter[1]) 

Filtering

bc_seq_filter reads in the sequence data and applies filters, then returns a ShortReadQ object which contains the filtered sequences.

The bc_seq_filter function can read fastq files, and it can also handle sequencing reads in ShortReadQ, DNAStringSet and data.frame.

The currently available filter parameters are: - min_average_quality: average base sequencing quality across read. - min_read_length: minimum number of bases per read. - N_threshold: maximum number of "N" bases in sequence.

# TODO: output the filtering percentage
# TODO: Trimming
fq_filter <- bc_seq_filter(
  fq_files,
  min_average_quality = 30,
  min_read_length = 60,
  sample_name = sample_name)

fq_filter
bc_plot_seqQc(bc_seq_qc(fq_filter))

Parse reads

One of the core applications of this package is parsing the sequences to get the barcode (and UMI). Our package uses regular expressions to identify barcodes (and UMI) from sequencing reads. This is how we tell bc_extract the structure of the input sequences.

3 arguments are necessary for bc_extract, they are: - x: the sequence data, it can be in fastq, ShortReadQ, DNAStringSet or data.frame format. - pattern: the sequence pattern regular expression. - pattern_type: pattern description.

The pattern argument is the regular expression, it tells the function where to find the barcode (or UMI). We capture the barcode (or UMI) by () in the backbone. For the sequence captured by (), the pattern_type argument tells which is the UMI or the barcode. In the example

pattern <- "([ACGA]{12})CTCGAGGTCATCGAAGTATC([ACGT]+)CCGTAGCAAGCTCGAGAGTAGACCTACT"
pattern_type <- c("UMI" = 1, "barcode" = 2)
  1. The sequence starts with 12 base pairs of random sequence, which is UMI. It is the first barcode captured by () in the pattern argument, and corresponds to UMI = 1 in the pattern_type argument.
  2. Then, there is a known constant sequence: CTCGAGGTCATCGAAGTATC.
  3. Following the constant region, there is flexible length random sequence. This is the barcode which is trapped by second (), and it is defined by barcode = 2 in the pattern_type argument.
  4. At the end of the sequence, there is another constant sequence CCGTAGCAAGCTCGAGAGTAGACCTACT.

In the regular expression, the UMI pattern is retrieved with [ACGT]{12}. The [ACGT] means to match "A", "C", "G" or "T", and the {12} means match 12 [ACGT]. In the barcode pattern [ACGT]+, again [ACGT] means match "A", "C", "G" or "T" and the + says to match at least one [ACGT].

The bc_extract function is used to extract the barcode(s) from the sequences. It returns a BarcodeObj object if the input is a list or a vector of Fastq files. The BarcodeObj created by bc_extract is a R S4 class with three slots: messyBc, metadata and cleanBc (which is NULL in the bc_extract output). They can be accessed by @ operator or corresponding accesors: - bc_messyBc: return the messyBc slot. - bc_cleanBc: return the cleanBc slot. - bc_meta: return the metadata slot.

messyBc is a list, where each element is a data.table corresponding to the successive samples. Each data.table has 3 columns:

  1. umi_seq (optional): UMI sequence, applicable when there is a UMI in pattern and pattern_type argument.
  2. barcode_seq: barcode sequence.
  3. count: the count of the full read sequence.

Attention: In the data.table, barcode_seq value may be not unique, as two different full read sequences can contain the same barcode sequence, due to the UMI or mutations in the constant region.

If the input to bc_extract is just a sample, the output is a single data.frame with the 3 columns 1). umi_seq, 2). barcode_seq and 3). count, as described above.

The sequence in match_seq is a contiguous segment of the full read given in reads_seq. The umi_seq and barcode_seq are contiguous segments of match_seq. Take note that, the reads_seq is the unique id for each row. The match_seq, umi_seq or barcode_seq can be duplicated, due to the potential variation in the region outside of match_seq. Please keep this in mind when you use data in $messyBc to perform the analysis.

Sequencing without UMI

In the following example, only a barcode is extracted.

pattern <- "CTCGAGGTCATCGAAGTATC([ACGT]+)CCGTAGCAAGCTCGAGAGTAGACCTACT"
bc_obj <- bc_extract(
  fq_filter,
  sample_name = sample_name,
  pattern = pattern,
  pattern_type = c(barcode = 1))

bc_obj
names(bc_messyBc(bc_obj)[[1]])

Here the regular expression matches a constant sequence at the beginning and the end and the barcode in () matches at least one of any character.

Sequencing with UMI

In the following example, both UMI and barcode are extracted. The regular expression is explained above.

pattern <- "([ACGA]{12})CTCGAGGTCATCGAAGTATC([ACGT]+)CCGTAGCAAGCTCGAGAGTAGACCTACT"
bc_obj_umi <- bc_extract(
  fq_filter,
  sample_name = sample_name,
  pattern = pattern,
  maxLDist = 0,
  pattern_type = c(UMI = 1, barcode = 2))

class(bc_obj_umi)
bc_obj_umi

Metadata updated

bc_extract added two columns named "row_read_count" and "barcode_read_count" to the metadata slot of the returned BarcodeObj object.

row_read_count: Total raw reads number of each sample. barcode_read_count: The number of reads that contain the barcodes.

You can use the ratio of barcode_read_count versus raw_read_count to check the successfulness of the sequencing or correctness of the pattern given to the bc_extract.

# select two samples from bc_obj_umi
bc_obj_umi_sub <- bc_obj_umi[, c("781_mixa", "781_mixb")]
# get the metadata matrix
(d <- bc_meta(bc_obj_umi_sub))
# use the row name of the metadata, which contains the sample names
d$sample_name <- rownames(d)

d$barcode_read_count / d$raw_read_count
# visualize
ggplot(d) + 
    aes(x=sample_name, y=barcode_read_count / raw_read_count) + 
    geom_bar(stat="identity")

Data management

Besides, we provide operators to handle the barcodes and samples in BarcodeObj object. You can easily select one or several samples by their names, indices or metadata.

Select slot by accesors:

# Access messyBc slot
head(bc_messyBc(bc_obj_umi)[[1]], n=2)
# return a data.frame
head(bc_messyBc(bc_obj_umi, isList=FALSE), n=2)

# Access cleanBc slot
# return a data.frame
head(bc_cleanBc(bc_obj_umi, isList=FALSE), n=2)

Select sample by sample names

bc_obj_umi_sub <- bc_obj_umi[, c("781_mixa", "781_mixb")]
bc_names(bc_obj_umi_sub)

Set metadata

bc_meta(bc_obj_umi_sub)$rep <- c("a", "b")
bc_meta(bc_obj_umi_sub)

Select sample by metadata

bc_subset(bc_obj_umi_sub, sample = rep == "a")

Barcode filtering

Most of the times, it needs PCR and NGS to read out the cellular barcode sequences. bc_extract will output all barcodes found in the sequences. Some of the identified barcodes may contain PCR or sequencing errors.

The potential errors derived from PCR and NGS lead to spurious barcodes that not existed in biological samples. The spurious barcodes are more likely to be less abundant comparing to corresponding "mother" barcodes they derived from.

As UMI can be used to label a DNA molecular, one UMI labeled barcode molecular becomes multiple copies by PCR. Thus all the sequences derived from the template sequence, including original template sequence and mutant ones, are marked by UMI for having the same UMI. The original template sequence is likely having more reads comparing to the spurious one derived from PCR or sequencing mutation, as errors happens with low probability. Also, a barcode sequence is less likely to be spurious one when it relates to several UMIs.

We created the bc_cure_* functions to perform filtering for removing the potential spurious barcodes. The bc_cure_* functions create or update the cleanBc slot in BarcodeObj. The cleanBc slot contains 2 columns - barcode_seq: barcode sequence. - counts: reads count, or UMI count in the case that the cleanBc was created by bc_cure_umi.

Important: The createBc slot, the barcode_seq is not duplicated in each sample.

In the bc_cure_* function family, there are bc_cure_depth, bc_cure_umi and bc_cure_cluster.

Filter UMI-barcode tag

In the case when the UMI is applied, the template sequence is marked by UMI, and we use "UMI-barcode tag" to denote a combination of a UMI and a barcode. The UMI-barcode tag with few reads are likely deriving from PCR or sequence errors. bc_cure_umi carries out the filtering based on the UMI-barcode tag read count from the messyBc slot in BarcodeObj object, and returns a updated BarcodeObj object with a cleanBc slot containing the barcodes passing the filtering.

# Filter the barcodes with UMI-barcode tag >= 1, 
# and treat UMI as absolute unique and do "fish"
bc_obj_umi_sub <- bc_cure_umi(
    bc_obj_umi_sub, depth = 1, 
    isUniqueUMI = TRUE, 
    doFish = TRUE)
bc_obj_umi_sub

The available arguments of bc_cure_umi are:

Filter by count

bc_cure_depth performs filtering by reads/UMI count. It can filter the raw barcodes in the messyBc and create a cleanBc slot , or update the cleanBc when the argument isUpdate is TRUE. You should set this argument to TRUE, when you want apply the filtering on the UMI count with the bc_cure_umi output. In this case, bc_cure_depth will update the cleanBc slot created by bc_cure_umi.

The function has two arguments:

# Apply the barcode sequence depth with depth >= 3
# With isUpdate = FLASE, the data in `messyBc` slot of bc_obj_umi_sub
#   will be used for depth filtering. The UMI information will be discarded, 
#   the identical barcodes in different UMI-barcode tags are merged before
#   performing the sequence depth filtering.
bc_obj_umi_sub <- bc_cure_depth(bc_obj_umi_sub, depth = 3, isUpdate = FALSE)
bc_obj_umi_sub

# Apply the UMI count filter, keep barcode >= 3 UMI
# The `bc_cure_umi` function applies the filtering on the UMI-barcode tags,
#   and create a `cleanBc` slot in the return BarcodeObj object. Then, 
#   the `bc_cure_depth` with `isUpdate` argument TRUE will apply the filtering
#   on the UMI counts in `cleanBc` and updated the `cleanBc`.
bc_obj_umi_sub <- bc_cure_umi(
    bc_obj_umi_sub, depth = 1, 
    isUniqueUMI = TRUE, 
    doFish = TRUE)
bc_obj_umi_sub
bc_obj_umi_sub <- bc_cure_depth(bc_obj_umi_sub, depth = 3, isUpdate = TRUE)
bc_obj_umi_sub

Cluster barcode by sequence similarity

The sequences with more reads have more chance to be the original templates. In contrast,the sequences with few reads are more likely derived from mutations of the most abundant sequence. Thus, the spurious sequence might be identified by comparing the most abundant sequence to the least one. If they are similar, the least abundant sequence will be removed.

bc_cure_cluster performs the clustering to remove the barcodes with insufficient depth (or UMI counts) comparing to most abundant ones with similarity, it needs the cleanBc slot and will update it.

To control the clustering methods and threshold for merging you need the following arguments:

# Do the clustering and merging the least abundant barcodes to the similar
# abundant ones
bc_cure_cluster(bc_obj_umi_sub)

Barcode count distribution

We provides bc_plot_single, bc_plot_mutual and bc_plot_pair functions for helping exploring the barcode count distribution for single sample or between two samples.

Single sample

bc_plot_single can be used for exploring barcode count distribution sample wise. It uses the cleanBc slot in the BarcodeObj bc_obj_umi_sub.

bc_plot_single(bc_obj_umi_sub)

The bc_plot_single function provides arguments for showing the potential cutoff point and highlighting specific barcodes.

# re-do the filtering using depth threshold 0 to include all barcodes.
bc_obj_umi_sub_neo <- bc_cure_depth(bc_obj_umi_sub, depth=0, isUpdate=FALSE)

# you can use the count_marks argument to display the cutoff points in the figure
# and the highlight argument to highlight specific barcodes.
bc_plot_single(bc_obj_umi_sub_neo, count_marks=10, 
    highlight= c("AAGTCCAGTACTATCGTACTA", "AAGTCCAGTACTGTAGCTACTA"))

Pairwise

bc_plot_mutual and bc_plot_pair are designed for comparing the barcodes between two samples.

The bc_plot_mutual generates a scatter plot matrix which contains all the pairwise sample combination in the provided BarcodeObj object.

# create a new BarcodeObj for following visualization
# use depth as 0 to include all the barcodes.
bc_obj_umi_neo <- bc_cure_depth(bc_obj_umi[, 1:4], depth=0)
# you can set the count_marks to display the cutoff point
# and highlight specific barcodes dots by highlight
bc_plot_mutual(bc_obj_umi_neo, count_marks=c(10, 20, 30, 40), 
    highlight= c("AAGTCCAGTACTATCGTACTA", "AAGTCCAGTACTGTAGCTACTA"))

And the bc_plot_pair only draws the scatter plot for the given sample pairs.

# create a new BarcodeObj for following visualization
# use depth as 0 to include all the barcodes.
bc_obj_umi_neo <- bc_cure_depth(bc_obj_umi[, 1:4], depth=0)

# 2d scatters plot with x axis of sample_x and y axis of sample_y
# sample_x, and sample_y can be the sample name or sample index
bc_plot_pair(
    bc_obj_umi_neo, 
    sample_x = c("50000_mixa"),
    sample_y = c("50000_mixb", "12500_mixa", "195_mixb"), 
    count_marks_x = 10,
    count_marks_y = c(10, 20, 30),
    highlight= c("AAGTCCAGTACTATCGTACTA", "AAGTCCAGTACTGTAGCTACTA")
)

Miscellaneous

We provides functions to transform the barcode information in BarcodeObj to more general R data types.

Sample names

bc_names(bc_obj_umi_sub)

Output to data.frame

bc_2df function uses the barcode and count info in the cleanBc slot, outputs a data.frame contains: - barcode_seq: barcode sequence - sample_name - count: reads or UMI count

bc_2df(bc_obj_umi_sub)

Or if you prefer data.table

bc_2dt(bc_obj_umi_sub)

Output to matrix

bc_2matrix uses barcode and count information in cleanBc slot to create reads count or UMI count matrix, with barcodes in rows and samples in columns.

bc_2matrix(bc_obj_umi_sub)

More

You can use:

For examples:

data(bc_obj)

# Join two samples with different barcodes 
bc_obj["AGAG", "test1"] + bc_obj["AAAG", "test1"]

# Join two samples with shared barcodes
bc_obj_join <- bc_obj["AGAG", "test1"] + bc_obj["AGAG", "test1"]
bc_obj_join

# In this case, the shared barcodes are not merged.
# Applying bc_cure_depth() to merge them.
bc_cure_depth(bc_obj_join)

# Remove barcodes
bc_obj - "AAAG"

# Select barcodes in white list
bc_obj * "AAAG"

What's more, by combining several functions, it is possible to accomplish more complex task. In the following example, a barcode from sample "781_mixa" is selected , then output the result in data.frame format.

bc_2df(bc_obj_umi_sub[bc_barcodes(bc_obj_umi_sub)[1], "781_mixa"])
                  ## 1. Use `bc_barcodes` to pull out all the barcodes in two
                  ##    samples, and choose the fist barcode.
       ## 2. Select the barcode got in step 1, and the sample named "781_mixa".
## 3. Convert the BarcodeObj object to a data.frame. 

Session Info

sessionInfo()


wenjie1991/Bc documentation built on Aug. 10, 2024, 11:02 a.m.