choosebank: To select a database structured under ACNUC and located on...

In seqinr: Biological Sequences Retrieval and Analysis

To select a database structured under ACNUC and located on the web

Description

This function allows to select one of the databases structured under ACNUC and located on the web. Called without arguments, choosebank(), will return the list of available databases. Then, you can use query to make your query and get a list of sequence names. Remote access to ACNUC databases works by opening a socket connection on a port (for example on port number 5558 at pbil.univ-lyon1.fr) and by communicating on this socket following the protocol described in the section references.

Usage

choosebank(bank = NA, host = "pbil.univ-lyon1.fr", port = 5558, server = FALSE,
                    blocking = TRUE, open = "a+", encoding = "", verbose = FALSE,
                    timeout = 5, infobank = FALSE, tagbank = NA)

Arguments

bank	string. The name of the bank. If NA, choosebank will return the names of all database known by the server.
host	string. Host name for port (see socketConnection)
port	integer. The TCP port number (see socketConnection)
server	logical. Should the socket be a client or a server? (see socketConnection)
blocking	logical. (see socketConnection)
open	string. A description of how to open the connection (see socketConnection)
encoding	string. The name of the encoding to be used. (see socketConnection)
verbose	logical. If TRUE, verbose mode is on
timeout	integer. The timeout in seconds for socketConnection. Default 5 seconds.
infobank	logical. If infobank is TRUE and bank is NA, a data.frame with all database informations will be returned
tagbank	string. If bank is NA and tagbank is documented, the names of special purposes databases are returned. Current allowed values are TP for frozen databases (TP is an acronym for "travaux pratiques" which means practicals in french, these databases are useful mainly for teaching so as to have stable results), TEST for test databases, and DEV for databases under development (unstable).

Details

When called without arguments, choosebank() returns a list of all the databases names known by the server, as a vector of string. When called with choosebank(infobank = TRUE), a data.frame with more information is returned.The environment .seqinrEnv is used to save several variables such as socket and sequence list.

Value

When called with a regular bank name, an (invisible) list with 6 components:

socket	an object of class socket
bankname	the name of the bank
banktype	the type of the bank (GENBANK, EMBL, SWISSPROT, NBRF)
totseqs	the total number of sequences present in the opened database
totspecs	the total number of species present in the opened database
totkeys	the total number of keywords present in the opened database

When called with bank = NA:

names

A vector of all available bank names.

When called with bank = NA and infobank = TRUE, a data.frame with three columns:

bank	The name of the bank.
status	The bank status (on/of).
info	Short description of bank with last release date.

Note

The invisible list returned when a database is opened is stored in the variable banknameSocket in the global environment.

Author(s)

D. Charif, J.R. Lobry

References

For more information about the socket communication protocol with ACNUC please get at https://doua.prabi.fr/databases/acnuc/remote_acnuc.html.
Gouy, M., Milleret, F., Mugnier, C., Jacobzone, M., Gautier,C. (1984) ACNUC: a nucleic acid sequence data base and analysis system. Nucl. Acids Res., 12:121-127.
Gouy, M., Gautier, C., Attimonelli, M., Lanave, C., Di Paola, G. (1985) ACNUC - a portable retrieval system for nucleic acid sequence databases: logical and physical designs and usage. Comput. Appl. Biosci., 3:167-172.
Gouy, M., Gautier, C., Milleret, F. (1985) System analysis and nucleic acid sequence banks. Biochimie, 67:433-436.

citation("seqinr")

See Also

where.is.this.acc if you have a sequence accession number but you don't know which database to open, query to make a query when a database is opened, connection, socketConnection

Examples

  ## Not run: # Need internet connection
  # Show available databases:
  choosebank()
  # Show frozen databases:
  choosebank(tag = "TP")
  # Select a database:
  choosebank("emblTP", tag = "TP")
  # Do something with the database:
  myseq <- gfrag("LMFLCHR36", start = 1, length = 30)
  stopifnot(myseq == "cgcgtgctggcggcaatgaagcgttcgatg")
  # Close the database:
  closebank()
## End(Not run)

seqinr documentation built on May 29, 2024, 6:36 a.m.