readGeneInput: Standardize reading of gene inputs

In GeneRegionScan: GeneRegionScan

Description

Internal function that will standardise the input of the many different form of sequences that can be used in Bioconductor.

Usage

readGeneInput(gene, genename=NULL, verbose=TRUE)

Arguments

gene	A number of gene sequences as DNAString, DNAStringSets or, character-vectors with sequence.
genename	Optional character string specifying a gene name to include in the plot. If not included and a FASTA sequence is given, it will default to the name in the FASTA sequence. Otherwise it will default to 'Unknown genename'.
verbose	TRUE or FALSE.

Details

This function is not meant to be run directly by the user. It will take a number of genes either as a vector of characters, a path to a FASTA format file, as a DNAstrings or DNAStringSet. It will then output them in FASTA format for use with other functions. Optional variable genename forces a new name.

The primary objective of this function is to make the sequence input simpler for other functions.

Value

A list of all sequences and their names, in exactly the same format as obtained with the deprecated function readFASTA.

Author(s)

Lasse Folkersen

See Also

geneRegionScan, plotOnGene

Examples

	somegene<-"ATACCTTGTAGGACCTGATGATAGATGCATAGTAATATCGTA"
	genename<-"My favourite gene"
	GeneRegionScan:::readGeneInput(somegene,genename=genename)

GeneRegionScan documentation built on Nov. 8, 2020, 8:28 p.m.