findSequenceInGenome: Find a sequence in genome

In GeneRegionScan: GeneRegionScan

Description

Wrapper around matchPDict that will accept a list of sequences and check if they are present in a given genome. Takes a long time to run.

Usage

findSequenceInGenome(sequences,
    genome="BSgenome.Hsapiens.UCSC.hg19", verbose=TRUE, 
    directions=c("matchForwardSense", "matchForwardAntisense",
                 "matchReverseSense", "matchReverseAntisense")) 

Arguments

sequences	vector of character strings to scan. Should only contain A, C, G and T. Will be converted to DNAString.
genome	character string with the name of the BSGenome in which sequences should be found. Defaults to the human genome.
verbose	TRUE or FALSE.
directions	character string with elements from c("matchForwardSense", "matchForwardAntisense", "matchReverseSense", "matchReverseAntisense"). Defines which directions (complementary and reverse mirrorings) that should be scanned. Defaults to all directions.

Details

This function will take quite a while to run, so if you have a many sequences, overnight runs are recommended. BSgenome contains some alternative versions of chromosomes. They are marked with an underscore. This function automatically disregards chromosome names with an underscore, and this is known to work for the human genome. Nevertheless, check the output printed to terminal if all chromosomes are included.

Value

A data frame with a row for each identified match. Columns are "entrynumber","hitposInChr","chr", and "sequence" describing, respectively: the index of the sequence match, the position in the chromosome at which it was found, which chromosome it was found on, the sequence itself

Author(s)

Lasse Folkersen

See Also

BSgenome, matchPDict, excludeDoubleMatchingProbes

Examples

	## Not run: 
	#you can run this, but it takes quite a lot of time
	example<-findSequenceInGenome("CTGGCGAGCAGCGAATAATGGTTT")
	
## End(Not run)

GeneRegionScan documentation built on Nov. 8, 2020, 8:28 p.m.