trimSeqs: Trim sequences from a specific side.

In hiReadsProcessor: Functions to process LM-PCR reads from 454/Illumina data

Description

This function trims a DNAStringSet object using the ranges from left, right, or middle of the sequence. This is a helper function utilized in primerIDAlignSeqs and extractSeqs. If dnaSet and coords are not the same length, then they are required to have a names attribute to perform the matched trimming.

Usage

trimSeqs(dnaSet, coords, side = "middle", offBy = 0)

Arguments

dnaSet	DNAStringSet object containing sequences to be trimmed.
coords	IRanges object containing boundaries.
side	either 'left','right',or the Default 'middle'.
offBy	integer value dictating if the supplied coordinates should be offset by X number of bases. Default is 0.

Value

a DNAStringSet object with trimmed sequences.

Note

If side is left, then any sequence following end of coords+offBy is returned. If side is right, then sequence preceding start of coords-offBy is returned. If side is middle, then sequence contained in coords is returned where offBy is added to start and subtracted from end in coords.

See Also

extractSeqs, primerIDAlignSeqs

Examples

dnaSet <- DNAStringSet(c("AAAAAAAAAACCTGAATCCTGGCAATGTCATCATC", 
"AAAAAAAAAAATCCTGGCAATGTCATCATCAATGG", "AAAAAAAAAAATCAGTTGTCAACGGCTAATACGCG",
"AAAAAAAAAAATCAATGGCGATTGCCGCGTCTGCA", "AAAAAAAAAACCGCGTCTGCAATGTGAGGGCCTAA",
"AAAAAAAAAAGAAGGATGCCAGTTGAAGTTCACAC"))
coords <- IRanges(start=1, width=rep(10,6))
trimSeqs(dnaSet, coords, side="left", offBy=1)
trimSeqs(dnaSet, coords, side="middle")

hiReadsProcessor documentation built on Nov. 8, 2020, 5:43 p.m.