Description Usage Arguments Value References Examples
View source: R/ncRNAtools_readWriteFunctions.R
Reads a file with the secondary structure of an RNA in the CT format (Connectivity Table).
1 |
filename |
A string indicating the path to the CT file to be read. A description of the CT format can be found at http://rna.urmc.rochester.edu/Text/File_Formats.html#CT. The CT file should contain information for all nucleotides of the RNA sequence, including those that do not form base pairs, unless the full-length RNA sequence is provided through the sequence argument. In such case, the CT file may contain only information for nucleotides involved in base pairs. |
sequence |
A string with the full-length sequence of the RNA whose secondary structure is represented in the CT file. Such argument is optional, but if it is not provided, a complete CT file with information for all nucleotides of the RNA must be provided. |
A list with the following 4 elements:
sequenceName |
name of the RNA sequence |
sequence |
RNA sequence |
sequenceLength |
number of nucleotides of the RNA sequence |
pairsTable |
a dataframe indicating the paired bases, in the same format as that returned by the findPairedBases function |
http://rna.urmc.rochester.edu/Text/File_Formats.html#CT.
1 2 3 4 5 6 7 8 9 10 11 12 13 | exampleCTFile <- system.file("extdata", "exampleCT.ct", package="ncRNAtools")
# If the CT file does not contain information for unpaired nucleotides, the
# original sequence must also be supplied in order to read it (tmRNA of E. coli
# encoded by the ssrA gene):
tmRNASequence <- "GGGGCUGAUUCUGGAUUCGACGGGAUUUGCGAAACCCAAGGUGCAUGCCGAGGGGCGGUUGG
CCUCGUAAAAAGCCGCAAAAAAUAGUCGCAAACGACGAAAACUACGCUUUAGCAGCUUAAUAACCUGCUUAGAGCCCUCU
CUCCCUAGCCUCCGCUCUUAGGACGGGGAUCAAGAGAGGUCAAACCCAAAAGAGAUCGCGUGGAAGCCCUGCCUGGGGUU
GAAGCGUUAAAACUUAAUCAGGCUAGUUUGUUAGUGGCGUGUCCGUCCGCAGCUGGCAAGCGAAUGUAAAGACUGACUAA
GCAUGUAGUACCGAGGAUGUAGGAAUUUCGGACGCGGGUUCAACUCCCGCCAGCUCCACCA"
tmRNASecondaryStructure <- readCT(exampleCTFile, tmRNASequence)
|
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.