writeCT: Writes a file with the secondary structure of an RNA in the...

In ncRNAtools: An R toolkit for non-coding RNA

Description

Writes a file with the secondary structure of an RNA in the CT format (Connectivity Table).

Usage

writeCT(filename, sequence, secondaryStructure=NULL, sequenceName="Sequence", pairedBases=NULL)

Arguments

filename	A string indicating the path to the CT file to be written. A description of the CT format can be found at http://rna.urmc.rochester.edu/Text/File_Formats.html#CT.
sequence	A string with the full-length sequence of the RNA for which a CT file should be written.
secondaryStructure	A string representing the secondary structure of the RNA sequence in the Dot-Bracket format. A correct value must be provided for either secondaryStructure or pairedBases. If a table of paired bases is provided through pairedBases, the string provided through secondaryStructure will be ignored. If no table of paired bases is provided, one will be internally calculated from the string representation of the secondary structure.
sequenceName	A string with the name of the sequence to be written in the first line of the CT file.
pairedBases	A table of paired bases in the same format as output by the findPairedBases function.

Value

Called for its effect of writing a CT file. Invisibly returns the status code returned by close when closing the file connection. See documentation of close for details.

References

http://rna.urmc.rochester.edu/Text/File_Formats.html#CT.

Examples

# Write a CT file by providing an RNA sequence and its secondary structure in
# the Dot-Bracket format:

tempDir <- tempdir()
CTFile <- paste(tempDir, "testCTFile.ct", sep="")
writeCT(CTFile, "AGCGGGUUCCUGGUUCCCCAAGGUUGA", 
secondaryStructure="...(((..((.))..))).((..))..",
sequenceName="Test sequence")

ncRNAtools documentation built on Nov. 8, 2020, 8:14 p.m.