maxScores-PQSViews-method: Get vector of maximal scores
In pqsfinder: Identification of potential quadruplex forming sequences

For each sequence position it gives the maximal score of all PQS conformations which overlap that position.

1 2	## S4 method for signature 'PQSViews' maxScores(x)

`x`	PQSViews object.

Vector of maximal scores.

1 2	pqs <- pqsfinder(DNAString("CCCCCCGGGTGGGTGGGTGGGAAAA")) maxScores(pqs)

pqsfinder documentation built on Nov. 8, 2020, 5:52 p.m.

pqsfinder index

pqsfinder: User Guide

Note that we can't provide technical support on individual packages. You should contact the package authors for that.

Description