maxScores-PQSViews-method: Get vector of maximal scores

Description Usage Arguments Value Examples

Description

For each sequence position it gives the maximal score of all PQS conformations which overlap that position.

Usage

1
2
## S4 method for signature 'PQSViews'
maxScores(x)

Arguments

x

PQSViews object.

Value

Vector of maximal scores.

Examples

1
2
pqs <- pqsfinder(DNAString("CCCCCCGGGTGGGTGGGTGGGAAAA"))
maxScores(pqs)

pqsfinder documentation built on Nov. 1, 2018, 4:28 a.m.