pqsfinder: Identify potential quadruplex forming sequences.

In pqsfinder: Identification of potential quadruplex forming sequences

Description

Function for identification of all potential intramolecular quadruplex patterns (PQS) in DNA or RNA sequence.

Usage

pqsfinder(subject, strand = "*", overlapping = FALSE, max_len = 50L,
  min_score = 47L, run_min_len = 2L, run_max_len = 11L,
  loop_min_len = 0L, loop_max_len = 30L, max_bulges = 3L,
  max_mismatches = 3L, max_defects = 3L, tetrad_bonus = 40L,
  mismatch_penalty = 28L, bulge_penalty = 20L,
  bulge_len_factor = 0.2, bulge_len_exponent = 1,
  loop_mean_factor = 6.6, loop_mean_exponent = 0.8,
  run_re = "G{1,10}.{0,9}G{1,10}", custom_scoring_fn = NULL,
  use_default_scoring = TRUE, deep = FALSE, verbose = FALSE)

Arguments

subject	DNAString or RNAString object.
strand	Strand specification. Allowed values are "+", "-" or "*", where the last one represents both strands. Implicitly, the input DNAString object is assumed to encode the "+" strand.
overlapping	If true, than all overlapping PQS will be reported.
max_len	Maximal lenth of PQS.
min_score	Minimal PQS score. The default value 52 shows the best balanced accuracy on G4 sequencing data provided by Chambers et al. 2015.
run_min_len	Minimal length of quadruplex run.
run_max_len	Maximal length of quadruplex run.
loop_min_len	Minimal length of quadruplex loop. Unless the default scoring system is disabled, at most one loop can have zero length.
loop_max_len	Maxmimal length of quadruplex loop.
max_bulges	Maximal number of runs with bulge.
max_mismatches	Maximal number of runs with mismatch.
max_defects	Maximum number of defects in total (max_bulges + max_mismatches).
tetrad_bonus	Score bonus for one complete G tetrade.
mismatch_penalty	Penalization for a mismatch in tetrad.
bulge_penalty	Penalization for a bulge in quadruplex run.
bulge_len_factor	Penalization factor for a bulge length.
bulge_len_exponent	Exponent of bulge length.
loop_mean_factor	Penalization factor of loop length mean.
loop_mean_exponent	Exponent of loop length mean.
run_re	Regular expression specifying one run of quadruplex.
custom_scoring_fn	Custom quadruplex scoring function. It takes the following 10 arguments: subject - Input DNAString or RNAString object, score - implicit PQS score, start - PQS start position, width - PQS width, loop_1 - start pos. of loop #1, run_2 - start pos. of run #2, loop_2 - start pos. of loop #2, run_3 - start pos. of run #3, loop_3 - start pos. of loop #3, run_4 - start pos. of run #4. Return value of the function has to be new score represented as a single integer value. Please note that if use_default_scoring is enabled, the custom scoring function is evaluated AFTER the default scoring system but ONLY IF the default scoring system resulted in non-zero score (for performance reasons). On the other hand, when use_default_scoring is disabled, custom scoring function is evaluated on every PQS.
use_default_scoring	Enables default internal scoring system. This option is particularly useful in case you intend to radically change the default behavior and specify your own scoring function. By disabling the default scoring you will get a full control above the underlying detection algorithm.
deep	Perform deep search. With this option enabled, maxScores and density vectors are computed. Deep search is much more computationaly demanding.
verbose	Enables detailed output. Turn it on if you want to see all possible PQS found at each positions and not just the best one. It is highly recommended to use this option for debugging custom quadruplex scoring function. Each PQS is reported on separate row in the following format: start cnt pqs_sequence score, where start is the PQS starting position, pqs_sequence shows the PQS sequence structure with each run surrounded by square brackets and score is the score assigned to the particular PQS by all applied scoring functions.

Details

Use elementMetadata function to get extra PQS features like number of tetrads (nt), bulges (nb), mismatches (nm) or loop lengths (ll1, ll2, ll3).

Value

PQSViews object

Examples

pv <- pqsfinder(DNAString("CCCCCCGGGTGGGTGGGTGGGTAAAA"))
pv
elementMetadata(pv)

pqsfinder documentation built on Nov. 8, 2020, 5:52 p.m.