density-PQSViews-method: Get density vector
In pqsfinder: Identification of potential quadruplex forming sequences

Desity vector represents numbers of PQS (potential quadruplex forming sequences) overlapping at each position in input sequence.

1 2	## S4 method for signature 'PQSViews' density(x)

`x`	PQSViews object.

Density vector.

1 2	pqs <- pqsfinder(DNAString("CCCCCCGGGTGGGTGGGTGGGAAAA")) density(pqs)

pqsfinder documentation built on Nov. 8, 2020, 5:52 p.m.

pqsfinder index

pqsfinder: User Guide

Note that we can't provide technical support on individual packages. You should contact the package authors for that.

Description