density-PQSViews-method: Get density vector

Description Usage Arguments Value Examples

Description

Desity vector represents numbers of PQS (potential quadruplex forming sequences) overlapping at each position in input sequence.

Usage

1
2
## S4 method for signature 'PQSViews'
density(x)

Arguments

x

PQSViews object.

Value

Density vector.

Examples

1
2
pqs <- pqsfinder(DNAString("CCCCCCGGGTGGGTGGGTGGGAAAA"))
density(pqs)

pqsfinder documentation built on Nov. 1, 2018, 4:28 a.m.