| TwoPrimerRemove | R Documentation |
Curates biological sequences of two restriction enzyme primers or cloning vectors.This cleaning is required for techniques such as cDNA-AFLP.
TwoPrimerRemove(SEQs, PrimerF, PrimerR)
SEQs |
DNAString containing biological sequences that are to be cleaned. |
PrimerF |
dnastring containing the foward primer/vector sequences to be removed. |
PrimerR |
dnastring containing the reverse primer/vector sequences to be removed. |
clean biological sequences and visualization of the alignments
Florencia I Pozzi, Silvina A. Felitti
SEQs = DNAString(paste("ACTTTCTGCTGCTTGTGGTCGCAATCAGAGTCCTGATGATGAGTCCTGA",
"CCGAACCCTTTTTCTCCGTCATCCGTTGGTCCATGGTACGCAATCAGAG", sep = ""))
PrimerF = DNAString("GATGAGTCCTGACCGAA")
PrimerR = DNAString("GACTGCGTACCATGC")
TwoPrimerRemove (SEQs,PrimerF,PrimerR)
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.