Description Usage Arguments Details Value Author(s) Examples
Codon Adaption Index
1 | SADEG.CAI(Nucleotide_Sequence)
|
Nucleotide_Sequence |
Nucleotide Sequence |
Geometric mean of the RSCU values presented as relative adaptiveness value (w), The CAI for a gene is then defined as the geometric mean of w values for codons in that gene excluding methionine, tryptophan, and stop codons.
CAI
Babak Khorsand
1 | SADEG.CAI(Nucleotide_Sequence="atggctgctgcagcggccagtcacgatcagaggtaagttgtcgcagcatgt")
|
CAI
0.8407065
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.