Description Usage Arguments Details Value Author(s) Examples
GC2 content.
1 | SADEG.GC2(Nucleotide_Sequence)
|
Nucleotide_Sequence |
Nucleotide Sequence |
GC2 content : Sum of frequencies of G and C at the second position of each codon.
GC2
Babak Khorsand
1 | SADEG.GC2(Nucleotide_Sequence="atggctgctgcagcggccagtcacgatcagaggtaagttgtcgcagcatgt")
|
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.