parse_rdp: Parse RDP FASTA release

In metacoder: Tools for Parsing, Manipulating, and Graphing Taxonomic Abundance Data

Parse RDP FASTA release

Description

Parses an RDP reference FASTA file.

Usage

parse_rdp(input = NULL, file = NULL, include_seqs = TRUE, add_species = FALSE)

Arguments

input	(character) One of the following: A character vector of sequences See the example below for what this looks like. The parser read_fasta produces output like this. A list of character vectors Each vector should have one base per element. A "DNAbin" object This is the result of parsers like read.FASTA. A list of "SeqFastadna" objects This is the result of parsers like read.fasta. Either "input" or "file" must be supplied but not both.
file	The path to a FASTA file containing sequences to use. Either "input" or "file" must be supplied but not both.
include_seqs	(logical of length 1) If TRUE, include sequences in the output object.
add_species	(logical of length 1) If TRUE, add the species information to the taxonomy. In this database, the species name often contains other information as well.

Details

The input file has a format like:

>S000448483 Sparassis crispa; MBUH-PIRJO&ILKKA94-1587/ss5	Lineage=Root;rootrank;Fun...
ggattcccctagtaactgcgagtgaagcgggaagagctcaaatttaaaatctggcggcgtcctcgtcgtccgagttgtaa
tctggagaagcgacatccgcgctggaccgtgtacaagtctcttggaaaagagcgtcgtagagggtgacaatcccgtcttt
...

Value

taxmap

See Also

Other parsers: extract_tax_data(), lookup_tax_data(), parse_dada2(), parse_edge_list(), parse_greengenes(), parse_mothur_tax_summary(), parse_mothur_taxonomy(), parse_newick(), parse_phyloseq(), parse_phylo(), parse_qiime_biom(), parse_silva_fasta(), parse_tax_data(), parse_ubiome(), parse_unite_general()

metacoder documentation built on April 4, 2023, 9:08 a.m.