write_rdp: Write an imitation of the RDP FASTA database

In metacoder: Tools for Parsing, Manipulating, and Graphing Taxonomic Abundance Data

Write an imitation of the RDP FASTA database

Description

Attempts to save taxonomic and sequence information of a taxmap object in the RDP FASTA format. If the taxmap object was created using parse_rdp, then it should be able to replicate the format exactly with the default settings.

Usage

write_rdp(
  obj,
  file,
  tax_names = obj$get_data("taxon_names")[[1]],
  ranks = obj$get_data("rdp_rank")[[1]],
  ids = obj$get_data("rdp_id")[[1]],
  info = obj$get_data("seq_name")[[1]],
  sequences = obj$get_data("rdp_seq")[[1]]
)

Arguments

obj	A taxmap object
file	(character of length 1) The file path to save the sequence fasta file. This is optional.
tax_names	(character named by taxon ids) The names of taxa
ranks	(character named by taxon ids) The ranks of taxa
ids	(character named by taxon ids) Sequence ids
info	(character named by taxon ids) Info associated with sequences. In the example output shown here, this field corresponds to "Sparassis crispa; MBUH-PIRJO&ILKKA94-1587/ss5"
sequences	(character named by taxon ids) Sequences

Details

The output file has a format like:

>S000448483 Sparassis crispa; MBUH-PIRJO&ILKKA94-1587/ss5	Lineage=Root;rootrank;Fun...
ggattcccctagtaactgcgagtgaagcgggaagagctcaaatttaaaatctggcggcgtcctcgtcgtccgagttgtaa
tctggagaagcgacatccgcgctggaccgtgtacaagtctcttggaaaagagcgtcgtagagggtgacaatcccgtcttt
...

See Also

Other writers: make_dada2_asv_table(), make_dada2_tax_table(), write_greengenes(), write_mothur_taxonomy(), write_silva_fasta(), write_unite_general()

metacoder documentation built on April 4, 2023, 9:08 a.m.