split a sequence into sub-sequences

Share:

Description

Split a sequence into sub-sequences of 3 (the default size) with no overlap between the sub-sequences.

Usage

1
splitseq(seq, frame = 0, word = 3)

Arguments

seq

a vector of chars

frame

an integer (0, 1, 2) giving the starting position to split the sequence

word

an integer giving the size of the sub-sequences

Value

This function returns a vector which contains the sub-sequences.

Author(s)

J.R. Lobry

References

citation("seqinr")

See Also

split

Examples

 1
 2
 3
 4
 5
 6
 7
 8
 9
10
11
12
13
14
15
cds <- s2c("aacgttgcaggtcgctcgctacgtagctactgttt")
#
# To obtain the codon sequence in frame 0:
#
stopifnot(identical(splitseq(cds), 
  c("aac", "gtt", "gca", "ggt", "cgc", "tcg", "cta", "cgt", "agc", "tac", "tgt")))
#
# Show the effect of frame and word with a ten char sequence:
#
(tenchar <- s2c("1234567890"))
splitseq(tenchar, frame = 0)
splitseq(tenchar, frame = 1)
splitseq(tenchar, frame = 2)
splitseq(tenchar, frame = 0, word = 2)
splitseq(tenchar, frame = 0, word = 1)

Want to suggest features or report bugs for rdrr.io? Use the GitHub issue tracker.