splitseq: split a sequence into sub-sequences

Description Usage Arguments Value Author(s) References See Also Examples


Split a sequence into sub-sequences of 3 (the default size) with no overlap between the sub-sequences.


splitseq(seq, frame = 0, word = 3)



a vector of chars


an integer (0, 1, 2) giving the starting position to split the sequence


an integer giving the size of the sub-sequences


This function returns a vector which contains the sub-sequences.


J.R. Lobry



See Also



cds <- s2c("aacgttgcaggtcgctcgctacgtagctactgttt")
# To obtain the codon sequence in frame 0:
  c("aac", "gtt", "gca", "ggt", "cgc", "tcg", "cta", "cgt", "agc", "tac", "tgt")))
# Show the effect of frame and word with a ten char sequence:
(tenchar <- s2c("1234567890"))
splitseq(tenchar, frame = 0)
splitseq(tenchar, frame = 1)
splitseq(tenchar, frame = 2)
splitseq(tenchar, frame = 0, word = 2)
splitseq(tenchar, frame = 0, word = 1)

Search within the seqinr package
Search all R packages, documentation and source code

Questions? Problems? Suggestions? or email at ian@mutexlabs.com.

Please suggest features or report bugs with the GitHub issue tracker.

All documentation is copyright its authors; we didn't write any of that.