Nothing
library("traits")
Get trait data for Willow (Salix spp.)
(salix <- betydb_search("Salix Vcmax")) #> # A tibble: 14 x 36 #> checked result_type id citation_id site_id treatment_id sitename city #> <int> <chr> <int> <int> <int> <int> <chr> <chr> #> 1 1 traits 39217 430 645 1342 "" Saare #> 2 1 traits 39218 430 645 1343 "" Saare #> 3 1 traits 39219 430 645 1344 "" Saare #> 4 1 traits 39220 430 645 1345 "" Saare #> 5 1 traits 25405 51 NA 1 <NA> <NA> #> 6 1 traits 39213 430 645 1342 "" Saare #> 7 1 traits 39214 430 645 1343 "" Saare #> 8 1 traits 39215 430 645 1344 "" Saare #> 9 1 traits 39216 430 645 1345 "" Saare #> 10 1 traits 39221 430 645 1342 "" Saare #> 11 1 traits 39222 430 645 1343 "" Saare #> 12 1 traits 39223 430 645 1344 "" Saare #> 13 1 traits 39224 430 645 1345 "" Saare #> 14 1 traits 37519 381 602 1220 <NA> <NA> #> # … with 28 more variables: lat <dbl>, lon <dbl>, scientificname <chr>, #> # commonname <chr>, genus <chr>, species_id <int>, cultivar_id <int>, #> # author <chr>, citation_year <int>, treatment <chr>, date <chr>, time <chr>, #> # raw_date <chr>, month <int>, year <int>, dateloc <chr>, trait <chr>, #> # trait_description <chr>, mean <dbl>, units <chr>, n <int>, statname <chr>, #> # stat <dbl>, notes <chr>, access_level <int>, cultivar <chr>, entity <lgl>, #> # method_name <lgl> # equivalent: # (out <- betydb_search("willow"))
Summarise data from the output data.frame
library("dplyr") salix %>% group_by(scientificname, trait) %>% mutate(.mean = as.numeric(mean)) %>% summarise(mean = round(mean(.mean, na.rm = TRUE), 2), min = round(min(.mean, na.rm = TRUE), 2), max = round(max(.mean, na.rm = TRUE), 2), n = length(n)) #> # A tibble: 4 x 6 #> # Groups: scientificname [4] #> scientificname trait mean min max n #> <chr> <chr> <dbl> <dbl> <dbl> <int> #> 1 Salix Vcmax 65 65 65 1 #> 2 Salix dasyclados Vcmax 46.1 34.3 56.7 4 #> 3 Salix sachalinensis × miyabeana Vcmax 79.3 79.3 79.3 1 #> 4 Salix viminalis Vcmax 43.0 20.0 61.3 8
Get sequences by id
ncbi_byid(ids = "360040093") #> taxon #> 1 Eristalis transversa #> taxonomy #> 1 Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta; Pterygota; Neoptera; Holometabola; Diptera; Brachycera; Muscomorpha; Syrphoidea; Syrphidae; Eristalinae; Eristalini; Eristalis #> gene_desc #> 1 Eristalis transversa voucher CNC:Diptera:102013 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial #> organelle gi_no acc_no keyword specimen_voucher #> 1 mitochondrion 360040093 JN991986.1 BARCODE CNC:Diptera:102013 #> lat_lon #> 1 38.4623 N 79.2417 W #> country #> 1 USA: Virginia, Reddish Knob Lookout, 14.5km W Briery Branch #> paper_title #> 1 The evolution of imperfect mimicry in hover flies (Diptera: Syrphidae) #> journal first_author uploaded_date length #> 1 Unpublished Penny,H.D. 03-NOV-2012 658 #> sequence #> 1 tactttatattttgtatttggaacatgagcgggtatagtaggaacttcattaagaattttaattcgagctgaattaggtcatccaggtgcattaattggtgatgatcaaatttataatgttattgtaacagctcatgcttttgttataattttttttatagtaatacctattataattggaggatttggaaattgattagtaccacttatattaggagctccagatatagcattccctcgaataaataatataagtttctgattattacctccttctttaactctattattagtaagaagtatagtagaaaatggggctggaacaggatgaacagtttatcctccattatcaagtaatattgcacatggaggagcctcagttgatttagcaattttttcacttcacttatcaggaatatcatctattttaggtgcagtaaattttattacaacagttattaatatacgatcaacaggaattacttatgatcgtatacctttatttgtttgatctgttgctattacagctttattattattattatcattaccagtactagcaggagctattacaatattattaactgatcgaaatttaaatacatcattctttgatccagcaggaggaggagaccctatcctgtaccaacacttattc
Get sequences searching by taxonomic name
out <- ncbi_searcher(taxa = "Umbra limi", seqrange = "1:2000") #> using sleep: 0 #> ══ 1 queries ═══════════════ #> ✔ Found: Umbra+limi #> ══ Results ═════════════════ #> #> ● Total: 1 #> ● Found: 1 #> ● Not Found: 0 head(out) #> taxon length #> 1 Umbra limi 298 #> 2 Umbra limi 761 #> 3 Umbra limi 765 #> 4 Umbra limi 764 #> 5 Umbra limi 743 #> 6 Umbra limi 758 #> gene_desc #> 1 Umbra limi voucher Umbra_limi_GLF16S large subunit ribosomal RNA gene, partial sequence; mitochondrial #> 2 Umbra limi voucher NXG2012264 rhodopsin (Rho) gene, partial cds #> 3 Umbra limi voucher NXG201250 rhodopsin (Rho) gene, partial cds #> 4 Umbra limi voucher NXG2012183 rhodopsin (Rho) gene, partial cds #> 5 Umbra limi voucher NXG201252 rhodopsin (Rho) gene, partial cds #> 6 Umbra limi voucher NXG2012231 rhodopsin (Rho) gene, partial cds #> acc_no gi_no #> 1 MT549086 1847697133 #> 2 KX146134 1049488959 #> 3 KX146015 1049488721 #> 4 KX145969 1049488629 #> 5 KX145777 1049488245 #> 6 KX145759 1049488209
traitbank(query = "MATCH (n:Trait) RETURN n LIMIT 1;") #> $columns #> [1] "n" #> #> $data #> $data[[1]] #> metadata.id metadata.labels data.eol_pk data.object_page_id #> 1 22529388 Trait R20-PK20910350 46581789 #> data.resource_pk #> 1 ReverseOf_globi:assoc:7296029-FBC:FB:SpecCode:4755-ATE-EOL_V2:281 #> data.scientific_name #> 1 Plantae #> data.source #> 1 Froese, R. and D. Pauly. Editors. 2019. FishBase. World Wide Web electronic publication. www.fishbase.org, version (08/2019). Accessed at <https://github.com/globalbioticinteractions/fishbase/archive/6ebceaacea18c6ff6c247182f9af8ad6fc05cc82.zip> on 25 May 2020.
Habitat data
birdlife_habitat(22721692) #> id Habitat (level 1) Habitat (level 2) Importance #> 1 22721692 Forest Subtropical/Tropical Dry major #> 2 22721692 Forest Subtropical/Tropical Moist Montane major #> 3 22721692 Forest Temperate suitable #> 4 22721692 Shrubland Subtropical/Tropical High Altitude suitable #> Occurrence #> 1 breeding #> 2 non-breeding #> 3 breeding #> 4 breeding
Threats data
birdlife_threats(22721692) #> id threat1 #> 1 22721692 Agriculture & aquaculture #> 2 22721692 Agriculture & aquaculture #> 3 22721692 Biological resource use #> 4 22721692 Climate change & severe weather #> 5 22721692 Climate change & severe weather #> 6 22721692 Climate change & severe weather #> 7 22721692 Invasive and other problematic species, genes & diseases #> 8 22721692 Invasive and other problematic species, genes & diseases #> 9 22721692 Invasive and other problematic species, genes & diseases #> 10 22721692 Invasive and other problematic species, genes & diseases #> 11 22721692 Invasive and other problematic species, genes & diseases #> 12 22721692 Invasive and other problematic species, genes & diseases #> 13 22721692 Natural system modifications #> 14 22721692 Natural system modifications #> 15 22721692 Residential & commercial development #> 16 22721692 Transportation & service corridors #> threat2 #> 1 Annual & perennial non-timber crops - Agro-industry farming #> 2 Annual & perennial non-timber crops - Small-holder farming #> 3 Logging & wood harvesting - Unintentional effects: (subsistence/small scale) [harvest] #> 4 Droughts #> 5 Habitat shifting & alteration #> 6 Storms & flooding #> 7 Invasive non-native/alien species/diseases - Sus scrofa #> 8 Invasive non-native/alien species/diseases - Unspecified species #> 9 Problematic native species/diseases - Dendroctonus frontalis #> 10 Problematic native species/diseases - Odocoileus virginianus #> 11 Problematic native species/diseases - Unspecified species #> 12 Problematic species/disease of unknown origin - Unspecified species #> 13 Fire & fire suppression - Trend Unknown/Unrecorded #> 14 Other ecosystem modifications #> 15 Housing & urban areas #> 16 Roads & railroads #> stresses #> 1 Ecosystem degradation, Ecosystem conversion, Other #> 2 Ecosystem degradation, Ecosystem conversion, Other #> 3 Ecosystem degradation #> 4 Ecosystem degradation #> 5 Ecosystem degradation, Ecosystem conversion #> 6 Ecosystem degradation #> 7 Ecosystem degradation, Ecosystem conversion #> 8 Species mortality #> 9 Ecosystem degradation #> 10 Ecosystem degradation #> 11 Ecosystem degradation, Reduced reproductive success #> 12 Species mortality #> 13 Ecosystem degradation, Ecosystem conversion #> 14 Ecosystem degradation, Ecosystem conversion #> 15 Ecosystem degradation, Ecosystem conversion, Species mortality, Other #> 16 Species mortality #> timing #> 1 Agriculture & aquaculture #> 2 Agriculture & aquaculture #> 3 Biological resource use #> 4 Climate change & severe weather #> 5 Climate change & severe weather #> 6 Climate change & severe weather #> 7 Invasive and other problematic species, genes & diseases #> 8 Invasive and other problematic species, genes & diseases #> 9 Invasive and other problematic species, genes & diseases #> 10 Invasive and other problematic species, genes & diseases #> 11 Invasive and other problematic species, genes & diseases #> 12 Invasive and other problematic species, genes & diseases #> 13 Natural system modifications #> 14 Natural system modifications #> 15 Residential & commercial development #> 16 Transportation & service corridors #> scope #> 1 Annual & perennial non-timber crops - Agro-industry farming #> 2 Annual & perennial non-timber crops - Small-holder farming #> 3 Logging & wood harvesting - Unintentional effects: (subsistence/small scale) [harvest] #> 4 Droughts #> 5 Habitat shifting & alteration #> 6 Storms & flooding #> 7 Invasive non-native/alien species/diseases - Sus scrofa #> 8 Invasive non-native/alien species/diseases - Unspecified species #> 9 Problematic native species/diseases - Dendroctonus frontalis #> 10 Problematic native species/diseases - Odocoileus virginianus #> 11 Problematic native species/diseases - Unspecified species #> 12 Problematic species/disease of unknown origin - Unspecified species #> 13 Fire & fire suppression - Trend Unknown/Unrecorded #> 14 Other ecosystem modifications #> 15 Housing & urban areas #> 16 Roads & railroads #> severity impact #> 1 Ongoing Ongoing #> 2 Ongoing Ongoing #> 3 Ongoing Ongoing #> 4 Ongoing Ongoing #> 5 Future Future #> 6 Ongoing Ongoing #> 7 Ongoing Ongoing #> 8 Ongoing Ongoing #> 9 Ongoing Ongoing #> 10 Ongoing Ongoing #> 11 Ongoing Ongoing #> 12 Ongoing Ongoing #> 13 Ongoing Ongoing #> 14 Future Future #> 15 Ongoing Ongoing #> 16 Ongoing Ongoing
Any scripts or data that you put into this service are public.
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.