MultiplePairwiseAlignmentsToOneSubject: Separately align multiple pattern sequences to one subject

In Close-your-eyes/igsc: Immunoglobolin sequences from scRNAseq

Separately align multiple pattern sequences to one subject

Description

This function is useful to visualise the alignment position of multiple patterns on one subject. It uses Biostrings::pairwiseAlignment(), obtains the individual alignment boundaries and converts the results to a ggplot object. The function will fail if a gap is induced in the subject and at least two pattern alignments overlap at this gap. Method = local-global avoids indels in subject. Local cuts subject and pattern to the best matching sequence of both.

Usage

MultiplePairwiseAlignmentsToOneSubject(
  subject,
  patterns,
  type = c("global-local", "global", "local", "overlap", "local-global"),
  max_mismatch = NA,
  order_patterns = F,
  fix_subject_indels = F,
  rm_indel_inducing_pattern = F,
  seq_type = NULL,
  return_max_mismatch_info_only = F,
  matches_to_subject_and_pattern = list(c(T, T), c(F, T), c(F, F)),
  compare_seq_df_long_args = list(seq_original = NULL, match_symbol = ".", change_pattern
    = T, pattern_mismatch_as = "base", change_ref = T, ref_mismatch_as = "base",
    insertion_as = "base"),
  pairwiseAlignment_args = list(),
  algnmt_plot_args = list(add_length_suffix = T, pattern_lim_size = 2, verbose = F),
  order_subject_ranges = F
)

Arguments

subject	a named character or named DNAStringSet of one subject (only the DNAStringSet but not DNAString can hold a name)
patterns	a named character vector or named DNAStringSet of patterns to align to the subject sequence
type	the type of alignment passed to Biostrings::pairwiseAlignment; not every type may work well with this function (if there are overlapping ranges of the alignments to the subject for example)
max_mismatch	only use patterns that have a maximum number of mismatches with the subject
order_patterns	order pattern increasingly by alignment position (start)
fix_subject_indels	in case of overlapping indels and shared subject ranges, cut respective patterns to avoid indels
seq_type	set sequence type to AA or NT if necessary; if NULL it is attempted to guess the type
return_max_mismatch_info_only	only return information on mismatches of patterns with the subject; in this case no alignment is calculated
order_subject_ranges

Value

a list

Examples

## Not run: 
s <- stats::setNames("AAAACCCCTTTTGGGGAACCTTCC", "sub")
s <- Biostrings::DNAStringSet(s)
p <- stats::setNames(c("TTCC", "CCCC", "TTTT", "GGGG", "AAAA"), c("pat1", "pat2", "pat3", "pat4", "pat5"))
p <- Biostrings::DNAStringSet(p)
als <- igsc::MultiplePairwiseAlignmentsToOneSubject(subject = s, patterns = p)
als_ordered <- igsc::MultiplePairwiseAlignmentsToOneSubject(subject = s, patterns = p, order_patterns = T)

## End(Not run)

Close-your-eyes/igsc documentation built on Jan. 28, 2024, 10:28 p.m.