intTrim: Reads filtration and trimming

In Heath1210/intSiteR: Process fastq files to get precise integration site coordinates

Description

Filter reads matching primer and linker, dump others. Adjust reads to same direction that linker is on the left side. Trim off linker and primer sequence followed by adding UMI, barcode to reads ID which has been simplied but informative enough to distinguish each reads. Save fasta files for further analysis.

Usage

intTrim(
  path2fq1,
  path2fq2,
  path2mg,
  outdir = NULL,
  LTR = "AGTCAGTGTGGAAAATCTCTAGCA",
  linker = "CTCCGCTTAAGGGACT",
  avoidseq1 = "GTGGCGCCCGAACAGGGACTTGAAAGCGAAAGGGAAACCAGAGGAGCTCT",
  avoidseq2 = "GTAGTAGTTCATGTCATCTTATTATTCAGTATTTATAACT"
)

Arguments

path2fq1	the file path to fq1 file.
path2fq2	the file path to fq2 file.
path2mg	the file path to merged fastq file.
outdir	the file fold where output files put in
LTR	the sequence of vector closest to integrated host genome. Recommended 18~28bp. Default value is for lentiviral vector. If you use other vector, change to corresponding sequence.
linker	the sequence of adaptor linker at the end, near the genome part. Default linker is from INSPIIRED pipeline. If you use other linker, change to corresponding sequence.
avoidseq1	Reads coontaining this sequence 1 will bring false positive integration site results. Default value is vector sequence close to 5'LTR tail. Change to NULL if you don't need it.
avoidseq2	Reads coontaining this sequence 2 will bring false positive integration site results Default value is vector sequence close to 3'LTR tail. Change to NULL if you don't need it.

Heath1210/intSiteR documentation built on Dec. 17, 2021, 10:32 p.m.