Description Usage Arguments Value Author(s) See Also Examples
View source: R/countPatternInSeqs.R
Output total number of patterns found in the input sequences
1 | countPatternInSeqs(pattern, sequences)
|
pattern |
DNAstringSet object |
sequences |
a vector of sequences |
Total number of occurrence of the pattern in the sequences
Lihua Julie Zhu
summarizePatternInPeaks, translatePattern
1 2 3 4 5 6 7 8 9 10 11 12 | library(Biostrings)
filepath =
system.file("extdata", "examplePattern.fa", package="ChIPpeakAnno")
dict = readDNAStringSet(filepath = filepath, format="fasta",
use.names=TRUE)
sequences = c("ACTGGGGGGGGCCTGGGCCCCCAAAT",
"AAAAAACCCCTTTTGGCCATCCCGGGACGGGCCCAT",
"ATCGAAAATTTCC")
countPatternInSeqs(pattern=dict[1], sequences=sequences)
countPatternInSeqs(pattern=dict[2], sequences=sequences)
pattern = DNAStringSet("ATNGMAA")
countPatternInSeqs(pattern=pattern, sequences=sequences)
|
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.