findre: Find the Restriction Sites on given DNA sequence

In LoadingBFX/rsrm: Locating restriction sites around specific target sequence and construct restriction map by fragments

Description

A function that find Restriction Sites on given DNA sequence by given restriction enzyme dataset. and plot the restriction site map by given number of sites you can choose how many sites at left/right of target to display.

Usage

findre(dnaName = "example DNA Sequence", dnaSeq, targetName = "Target",
  targetSeq, dataset = redata, num = 6,
  title = "Restriction map around the target sequence")

Arguments

dnaName	String, The name of the DNA sequence,
dnaSeq	String, The sequence of the DNA
targetName	String, The name of the target you want to produce, defualt is just "Target".
targetSeq	String, The sequence of the target you want to produce.
dataset	The dataset stores the information of enzymes with two column, name and site.
num	The number of enzyme on the left/right side of target sequence, defualt is 6
title	The title of the plot.defualt is "Restriction map around the target sequence"

Value

the distribution of restriction site arround the target sequence

Examples

seq1 <- 'GGCAGATTCCCCCTAACGTCGGACCCGCCCGCACCATGGTCAGGCATGCCCCTCCTCATCGCTGGGCACAGCCCAGAGGGT
ATAAACAGTGCTGGAGGCTGGCGGGGCAGGCCAGCTGAGTCCTGAGCAGCAGCCCAGCGCAGCCACCGAGACACC
ATGAGAGCCCTCACACTCCTCGCCCTATTGGCCCTGGCCGCACTTTGCATCGCTGGCCAGGCAGGTGAGTGCCCC'
name1 <- 'example DNA Sequence'
seq2 <- 'ACGTCG'
name2 <- 'Target'
result <- findre(name1, seq1, name2, seq2)
result

LoadingBFX/rsrm documentation built on Dec. 8, 2019, 8:40 a.m.