parse_rdp: Parse RDP FASTA release

Description Usage Arguments Details Value See Also

View source: R/parsers.R

Description

Parses an RDP reference FASTA file.

Usage

1
2
parse_rdp(input = NULL, file = NULL, include_seqs = TRUE,
  add_species = FALSE)

Arguments

input

(character) One of the following:

A character vector of sequences

See the example below for what this looks like. The parser read_fasta produces output like this.

A list of character vectors

Each vector should have one base per element.

A "DNAbin" object

This is the result of parsers like read.FASTA.

A list of "SeqFastadna" objects

This is the result of parsers like read.fasta.

Either "input" or "file" must be supplied but not both.

file

The path to a FASTA file containing sequences to use. Either "input" or "file" must be supplied but not both.

include_seqs

(logical of length 1) If TRUE, include sequences in the output object.

add_species

(logical of length 1) If TRUE, add the species information to the taxonomy. In this database, the species name often contains other information as well.

Details

The input file has a format like:

1
2
3
4
>S000448483 Sparassis crispa; MBUH-PIRJO&ILKKA94-1587/ss5	Lineage=Root;rootrank;Fun...
ggattcccctagtaactgcgagtgaagcgggaagagctcaaatttaaaatctggcggcgtcctcgtcgtccgagttgtaa
tctggagaagcgacatccgcgctggaccgtgtacaagtctcttggaaaagagcgtcgtagagggtgacaatcccgtcttt
...

Value

taxmap

See Also

Other parsers: parse_edge_list, parse_greengenes, parse_mothur_tax_summary, parse_mothur_taxonomy, parse_newick, parse_phyloseq, parse_phylo, parse_qiime_biom, parse_silva_fasta, parse_ubiome, parse_unite_general


grunwaldlab/metacoder documentation built on Oct. 2, 2018, 10:25 p.m.