#' Convert a phyloseq to taxmap
#'
#' Converts a phyloseq object to a taxmap object.
#'
#' @param obj A phyloseq object
#' @param class_regex A regular expression used to parse data in the taxon
#' names. There must be a capture group (a pair of parentheses) for each item
#' in \code{class_key}. See \code{\link{parse_tax_data}} for examples of
#' how this works.
#' @inheritParams parse_tax_data
#'
#' @return A taxmap object
#'
#' @family parsers
#'
#' @examples \dontrun{
#'
#' # Install phyloseq to get example data
#' # source('http://bioconductor.org/biocLite.R')
#' # biocLite('phyloseq')
#'
#' # Parse example dataset
#' library(phyloseq)
#' data(GlobalPatterns)
#' x <- parse_phyloseq(GlobalPatterns)
#'
#' # Plot data
#' heat_tree(x,
#' node_size = n_obs,
#' node_color = n_obs,
#' node_label = taxon_names,
#' tree_label = taxon_names)
#'
#' }
#'
#'
#' @export
parse_phyloseq <- function(obj, class_regex = "(.*)",
class_key = "taxon_name") {
datasets <- list()
mappings <- c()
# Parse taxonomic data
possible_ranks <- unique(unlist(strsplit(ranks_ref$ranks, split = ",")))
tax_data <- as.data.frame(obj@tax_table, stringsAsFactors = FALSE)
tax_cols <- colnames(tax_data)
tax_data <- cbind(data.frame(otu_id = rownames(tax_data), stringsAsFactors = FALSE), tax_data)
# Parse OTU tables
if (! is.null(obj@otu_table)) {
otu_table <- obj@otu_table
if (! otu_table@taxa_are_rows) {
otu_table <- t(otu_table)
}
otu_table <- as.data.frame(otu_table, stringsAsFactors = FALSE)
otu_table <- cbind(data.frame(otu_id = rownames(otu_table), stringsAsFactors = FALSE), otu_table)
datasets <- c(datasets, list(otu_table = otu_table))
mappings <- c(mappings, c("{{name}}" = "{{name}}"))
}
# Parse sample data
if (! is.null(obj@sam_data)) {
sam_data <- as.data.frame(as.list(obj@sam_data), stringsAsFactors = FALSE)
if (! is.null(rownames(obj@sam_data)) & !"sample_id" %in% colnames(obj@sam_data)) {
sam_data <- cbind(sample_id = rownames(obj@sam_data), sam_data)
}
sam_data[] <- lapply(sam_data, as.character)
datasets <- c(datasets, list(sample_data = sam_data))
mappings <- c(mappings, NA)
}
# Parse phylogenetic tree
if (! is.null(obj@phy_tree)) {
datasets <- c(datasets, list(phy_tree = obj@phy_tree))
mappings <- c(mappings, NA)
}
# Parse reference sequences
if (! is.null(obj@refseq)) {
refseq <- as.character(obj@refseq)
datasets <- c(datasets, list(ref_seq = refseq))
mappings <- c(mappings, c("{{name}}" = "{{name}}"))
}
# Construct output
output <- parse_tax_data(tax_data = tax_data,
datasets = datasets,
class_cols = tax_cols,
mappings = mappings,
named_by_rank = TRUE,
class_regex = class_regex,
class_key = class_key)
# Remove NA taxa
withCallingHandlers({
output$filter_taxa(output$taxon_names() != "NA")
}, warning=function(w) {
if (conditionMessage(w) %in% c(
'There is no "taxon_id" column in the data set "3", so there are no taxon IDs.',
'The data set "4" is named, but not named by taxon ids.'
))
invokeRestart("muffleWarning")
})
# Move OTU table to front of data if it is there
if ("otu_table" %in% names(output$data)) {
otu_tab_index <- which(names(output$data) == "otu_table")
output$data <- c(output$data[otu_tab_index], output$data[-otu_tab_index])
}
return(output)
}
#' Parse mothur *.tax.summary Classify.seqs output
#'
#' Parse the `*.tax.summary` file that is returned by the `Classify.seqs` command
#' in mothur.
#'
#' The input file has a format like:
#'
#' \preformatted{
#' taxlevel rankID taxon daughterlevels total A B C
#' 0 0 Root 2 242 84 84 74
#' 1 0.1 Bacteria 50 242 84 84 74
#' 2 0.1.2 Actinobacteria 38 13 0 13 0
#' 3 0.1.2.3 Actinomycetaceae-Bifidobacteriaceae 10 13 0 13 0
#' 4 0.1.2.3.7 Bifidobacteriaceae 6 13 0 13 0
#' 5 0.1.2.3.7.2 Bifidobacterium_choerinum_et_rel. 8 13 0 13 0
#' 6 0.1.2.3.7.2.1 Bifidobacterium_angulatum_et_rel. 1 11 0 11 0
#' 7 0.1.2.3.7.2.1.1 unclassified 1 11 0 11 0
#' 8 0.1.2.3.7.2.1.1.1 unclassified 1 11 0 11 0
#' 9 0.1.2.3.7.2.1.1.1.1 unclassified 1 11 0 11 0
#' 10 0.1.2.3.7.2.1.1.1.1.1 unclassified 1 11 0 11 0
#' 11 0.1.2.3.7.2.1.1.1.1.1.1 unclassified 1 11 0 11 0
#' 12 0.1.2.3.7.2.1.1.1.1.1.1.1 unclassified 1 11 0 11 0
#' 6 0.1.2.3.7.2.5 Bifidobacterium_longum_et_rel. 1 2 0 2 0
#' 7 0.1.2.3.7.2.5.1 unclassified 1 2 0 2 0
#' 8 0.1.2.3.7.2.5.1.1 unclassified 1 2 0 2 0
#' 9 0.1.2.3.7.2.5.1.1.1 unclassified 1 2 0 2 0
#' }
#'
#' or
#'
#' \preformatted{
#' taxon total A B C
#' "k__Bacteria";"p__Actinobacteria";"c__Actinobacteria";... 1 0 1 0
#' "k__Bacteria";"p__Actinobacteria";"c__Actinobacteria";... 1 0 1 0
#' "k__Bacteria";"p__Actinobacteria";"c__Actinobacteria";... 1 0 1 0
#' }
#'
#' @param file (\code{character} of length 1) The file path to the input file.
#' Either "file", "text", or "table" must be used, but only one.
#' @param text (\code{character}) An alternate input to "file". The contents of
#' the file as a character. Either "file", "text", or "table" must be used,
#' but only one.
#' @param table (\code{character} of length 1) An already parsed data.frame or
#' tibble. Either "file", "text", or "table" must be used, but only one.
#'
#' @return \code{\link{taxmap}}
#'
#' @family parsers
#'
#' @export
parse_mothur_tax_summary <- function(file = NULL, text = NULL, table = NULL) {
# Check that `file` and `text` and `table` are not used together
are_missing <- c(file = is.null(file),
text = is.null(text),
table = is.null(table))
if (sum(are_missing) != 2) {
stop(paste0('Either "file", "text", or "table" must be supplied, but only one.'))
}
# Read raw data
if (! are_missing["file"]) {
raw_data <- utils::read.csv(file = file, header = TRUE, sep = "\t",
stringsAsFactors = FALSE)
} else if (! are_missing["text"]) {
raw_data <- utils::read.csv(text = text, header = TRUE, sep = "\t",
stringsAsFactors = FALSE)
} else {
if (!is.data.frame(table)) {
stop('The "table" input requires a data.frame or tibble.')
}
raw_data <- table
}
# Check that it is an accepted format
detailed_cols <- c("taxlevel", "rankID", "taxon", "daughterlevels", "total")
simple_cols <- c("taxon", "total")
if (all(detailed_cols %in% colnames(raw_data))) {
is_detailed <- TRUE
} else if (all(simple_cols %in% colnames(raw_data))) {
is_detailed <- FALSE
} else {
stop("Format not recognized.")
}
if (is_detailed) {
# parse raw table
output <- parse_tax_data(tax_data = raw_data,
class_cols = "rankID",
class_sep = ".")
# replace taxon names
my_taxon_names <- output$map_data_(output$taxon_ids(),
output$get_data("taxon")[[1]])
my_taxon_names <- as.character(my_taxon_names)
output$taxa <- stats::setNames(lapply(seq_len(length(output$taxa)),
function(i) {
my_taxon <- output$taxa[[i]]
my_taxon$name$name <- my_taxon_names[i]
return(my_taxon)
}),
names(output$taxa))
} else { # is simple format
output <- parse_tax_data(tax_data = raw_data,
class_cols = "taxon",
class_sep = ";")
}
return(output)
}
#' Parse mothur Classify.seqs *.taxonomy output
#'
#' Parse the `*.taxonomy` file that is returned by the `Classify.seqs` command
#' in mothur. If confidence scores are present, they are included in the output.
#'
#' The input file has a format like:
#'
#' \preformatted{
#' AY457915 Bacteria(100);Firmicutes(99);Clostridiales(99);Johnsone...
#' AY457914 Bacteria(100);Firmicutes(100);Clostridiales(100);Johnso...
#' AY457913 Bacteria(100);Firmicutes(100);Clostridiales(100);Johnso...
#' AY457912 Bacteria(100);Firmicutes(99);Clostridiales(99);Johnsone...
#' AY457911 Bacteria(100);Firmicutes(99);Clostridiales(98);Ruminoco...
#' }
#'
#' or...
#'
#' \preformatted{
#' AY457915 Bacteria;Firmicutes;Clostridiales;Johnsonella_et_rel.;J...
#' AY457914 Bacteria;Firmicutes;Clostridiales;Johnsonella_et_rel.;J...
#' AY457913 Bacteria;Firmicutes;Clostridiales;Johnsonella_et_rel.;J...
#' AY457912 Bacteria;Firmicutes;Clostridiales;Johnsonella_et_rel.;J...
#' AY457911 Bacteria;Firmicutes;Clostridiales;Ruminococcus_et_rel.;...
#' }
#'
#' @param file (\code{character} of length 1) The file path to the input file.
#' Either "file" or "text" must be used, but not both.
#' @param text (\code{character}) An alternate input to "file". The contents of
#' the file as a character. Either "file" or "text" must be used, but not both.
#'
#' @return \code{\link{taxmap}}
#'
#' @family parsers
#'
#' @export
parse_mothur_taxonomy <- function(file = NULL, text = NULL) {
# Check that both `file` and `text` are not used together
if ((!missing(file) && !missing(text)) || (missing(file) && missing(text))) {
stop(paste0('Either "file" or "text" must be supplied, but not both.'))
}
# Convert file or text to a char vector of lines
if (! missing(file)) {
raw_lines <- readLines(file)
} else { # "text" must have been supplied
raw_lines <- unlist(strsplit(text, "\r\n?|\n"))
}
# Determine if there are scores associated with each taxon
parts <- strsplit(raw_lines[1], ";")[[1]]
has_scores <- all(grepl(parts, pattern = "^(.+)\\(([0-9]+)\\)$"))
# Parse raw lines
if (has_scores) {
output <- extract_tax_data(tax_data = raw_lines,
class_sep = ";",
key = c("sequence_id" = "info",
raw_tax = "class"),
regex = "^(.+)\\t(.+);$",
class_key = c(name = "taxon_name",
score = "info"),
class_regex = "^(.+)\\(([0-9]+)\\)$")
} else {
output <- extract_tax_data(tax_data = raw_lines,
class_sep = ";",
key = c("sequence_id" = "info",
raw_tax = "class"),
regex = "^(.+)\\t(.+);$")
}
# report results of parsing
message(paste0('Parsed ', length(raw_lines), ' lines as ',
length(output$taxa), ' unique taxa.'))
return(output)
}
#' Parse a BIOM output from QIIME
#'
#' Parses a file in BIOM format from QIIME into a taxmap object.
#' This also seems to work with files from MEGAN.
#' I have not tested if it works with other BIOM files.
#'
#' This function was inspired by the tutorial created by Geoffrey Zahn at
#' http://geoffreyzahn.com/getting-your-otu-table-into-r/.
#'
#' @param file (\code{character} of length 1) The file path to the input file.
#' @param class_regex A regular expression used to parse data in the taxon
#' names. There must be a capture group (a pair of parentheses) for each item
#' in \code{class_key}. See \code{\link{parse_tax_data}} for examples of
#' how this works.
#' @inheritParams parse_tax_data
#'
#' @return A taxmap object
#'
#' @family parsers
#'
#' @export
parse_qiime_biom <- function(file, class_regex = "(.*)",
class_key = "taxon_name") {
# Check that the "biomformat" package has been installed
check_for_pkg("biomformat")
# Read biom file
my_biom <- biomformat::read_biom(file)
# Get taxonomy
taxonomy <- biomformat::observation_metadata(my_biom)
if (is.null(taxonomy)) {
stop(call. = FALSE,
'Could not find taxonomy data in "', file,
'". If it does have taxonomy data, then it is not where this function expects it to be. ',
'If you think this is a bug, let us know at "', repo_url(), '/issues"')
}
tax_cols <- colnames(taxonomy)
# Get OTU IDs
if (is.data.frame(taxonomy)) {
otu_ids <- rownames(taxonomy)
} else {
otu_ids <- names(taxonomy)
}
# Coerce into a matrix
otu_table <- as.data.frame(as.matrix(biomformat::biom_data(my_biom)),
stringsAsFactors = FALSE)
otu_table <- cbind(list(otu_id = otu_ids), otu_table,
stringsAsFactors = FALSE)
# Get sample metadata (not used yet)
metadata <- biomformat::sample_metadata(my_biom)
# Create a taxmap object
if (is.data.frame(taxonomy)) {
output <- parse_tax_data(tax_data = taxonomy,
class_cols = colnames(taxonomy),
datasets = list(otu_table = otu_table),
mappings = c("{{name}}" = "{{name}}"),
include_tax_data = FALSE,
class_regex = class_regex,
class_key = class_key)
} else {
output <- parse_tax_data(tax_data = taxonomy,
datasets = list(otu_table = otu_table),
mappings = c("{{name}}" = "{{name}}"),
include_tax_data = FALSE,
class_regex = class_regex,
class_key = class_key)
}
return(output)
}
#' Parse a Newick file
#'
#' Parse a Newick file into a taxmap object.
#'
#' The input file has a format like:
#'
#' \preformatted{
#' (ant:17, (bat:31, cow:22):7, dog:22, (elk:33, fox:12):40);
#' (dog:20, (elephant:30, horse:60):20):50;
#' }
#'
#' @param file (\code{character} of length 1) The file path to the input file. Either \code{file} or \code{text} must be supplied but not both.
#' @param text (\code{character} of length 1) The raw text to parse. Either \code{file} or \code{text} must be supplied but not both.
#'
#' @return \code{\link{taxmap}}
#'
#' @family parsers
#'
#' @export
parse_newick <- function(file = NULL, text = NULL) {
# Check that the "phylotate" package has been installed
check_for_pkg("phylotate")
# Check that `file` and `text` and `table` are not used together
if (sum(c(is.null(file), is.null(text))) != 1) {
stop(paste0('Either "file" or "text" must be supplied, but not both.'))
}
# Read raw data
if (is.null(file)) {
file <- tempfile()
readr::write_lines(text, file)
}
# Read input
raw_data <- phylotate::read_annotated(file, format = "newick")
# Parse edge list
output <- parse_phylo(raw_data)
return(output)
}
#' Parse UNITE general release FASTA
#'
#' Parse the UNITE general release FASTA file
#'
#' The input file has a format like:
#'
#' \preformatted{
#' >Glomeromycota_sp|KJ484724|SH523877.07FU|reps|k__Fungi;p__Glomeromycota;c__unid...
#' ATAATTTGCCGAACCTAGCGTTAGCGCGAGGTTCTGCGATCAACACTTATATTTAAAACCCAACTCTTAAATTTTGTAT...
#' }
#'
#' @inheritParams parse_seq_input
#' @param include_seqs (\code{logical} of length 1) If \code{TRUE}, include
#' sequences in the output object.
#'
#' @return \code{\link{taxmap}}
#'
#' @family parsers
#'
#' @export
parse_unite_general <- function(input = NULL, file = NULL, include_seqs = TRUE) {
# Read sequence info
seqs <- parse_seq_input(input = input, file = file)
headers <- names(seqs)
# Create taxmap object
output <- extract_tax_data(tax_data = headers,
regex = "^(.*)\\|(.*)\\|(.*)\\|(.*)\\|(.*)$",
key = c(organism = "info",
acc_num = "info",
unite_id = "info",
unite_type = "info",
tax_string = "class"),
class_regex = "^(.*)__(.*)$",
class_key = c(unite_rank = "taxon_rank",
name = "taxon_name"),
class_sep = ";")
# Remove unneeded columns
output$data$tax_data$input <- NULL
if ("tax_string" %in% names( output$data$tax_data)) {
output$data$tax_data$tax_string <- NULL
}
# Add sequences
if (include_seqs) {
output$data$tax_data$unite_seq <- toupper(seqs)
}
return(output)
}
#' Parse RDP FASTA release
#'
#' Parses an RDP reference FASTA file.
#'
#' The input file has a format like:
#'
#' \preformatted{
#' >S000448483 Sparassis crispa; MBUH-PIRJO&ILKKA94-1587/ss5 Lineage=Root;rootrank;Fun...
#' ggattcccctagtaactgcgagtgaagcgggaagagctcaaatttaaaatctggcggcgtcctcgtcgtccgagttgtaa
#' tctggagaagcgacatccgcgctggaccgtgtacaagtctcttggaaaagagcgtcgtagagggtgacaatcccgtcttt
#' ...
#' }
#'
#' @inheritParams parse_seq_input
#' @param include_seqs (\code{logical} of length 1) If \code{TRUE}, include
#' sequences in the output object.
#' @param add_species (\code{logical} of length 1) If \code{TRUE}, add the
#' species information to the taxonomy. In this database, the species name
#' often contains other information as well.
#'
#' @return \code{\link{taxmap}}
#'
#' @family parsers
#'
#' @export
parse_rdp <- function(input = NULL, file = NULL, include_seqs = TRUE, add_species = FALSE) {
# Read sequence info
raw_data <- parse_seq_input(input = input, file = file)
headers <- names(raw_data)
# Add species to classification if present
if (add_species) {
org_name <- stringr::str_match(headers, "^.*? (.*)\\tLineage=.*$")[, 2]
genus <- stringr::str_match(headers, ";([a-zA-Z]+);genus$")[, 2]
species <- vapply(seq_len(length(org_name)), FUN.VALUE = character(1), function (i) {
sub(org_name[i], pattern = paste0("^", genus[i], " ?"), replacement = "") %>%
sub(pattern = ";.*$", replacement = "")
})
headers <- paste0(headers, ";", species, ";",
ifelse(endsWith(headers, ";"), "", "species"))
}
# Create taxmap object
output <- extract_tax_data(tax_data = headers,
regex = "^(.*?) (.*)\\tLineage=(.*)$",
key = c(rdp_id = "info", seq_name = "info",
tax_string = "class"),
class_regex = "(.+?);(.*?)(?:;|$)",
class_key = c(name = "taxon_name",
rdp_rank = "info"))
# Add sequences
if (include_seqs) {
seqs <- raw_data[output$data$tax_data$input]
output$data$tax_data$rdp_seq <- tolower(seqs)
}
# Remove unneeded columns
output$data$tax_data$input <- NULL
output$data$tax_data$tax_string <- NULL
return(output)
}
#' Parse SILVA FASTA release
#'
#' Parses an SILVA FASTA file that can be found at
#' \url{https://www.arb-silva.de/no_cache/download/archive/release_128/Exports/}.
#'
#' The input file has a format like:
#'
#' \preformatted{ >GCVF01000431.1.2369
#' Bacteria;Proteobacteria;Gammaproteobacteria;Oceanospiril...
#' CGUGCACGGUGGAUGCCUUGGCAGCCAGAGGCGAUGAAGGACGUUGUAGCCUGCGAUAAGCUCCGGUUAGGUGGCAAACA
#' ACCGUUUGACCCGGAGAUCUCCGAAUGGGGCAACCCACCCGUUGUAAGGCGGGUAUCACCGACUGAAUCCAUAGGUCGGU
#' ... }
#'
#' @inheritParams parse_seq_input
#' @param include_seqs (\code{logical} of length 1) If \code{TRUE}, include
#' sequences in the output object.
#'
#' @return \code{\link{taxmap}}
#'
#' @family parsers
#'
#' @export
parse_silva_fasta <- function(file = NULL, input = NULL, include_seqs = TRUE) {
# Read sequence info
raw_data <- parse_seq_input(input = input, file = file)
raw_headers <- names(raw_data)
# Make classifications easier to parse
name_chars <- "A-Za-z0-9._+ ='\"\\-"
parts <- stringr::str_match(raw_headers,
paste0("^(.+;)([", name_chars, "]+)(\\(?.*\\)?)$"))
parts <- as.data.frame(parts[, -1], stringsAsFactors = FALSE)
colnames(parts) <- c("tax", "binom", "common")
parts$binom <- sub(parts$binom, pattern = "sp\\. ", replacement = "sp\\._")
parts$binom <- sub(parts$binom, pattern = "uncultured ", replacement = "uncultured_")
# parts$binom <- gsub(pattern = " ", replacement = ";", parts$binom)
parts$binom <- sub(pattern = ";$", replacement = " ", parts$binom)
headers <- apply(parts, MARGIN = 1, paste0, collapse = "")
headers <- gsub(headers, pattern = "\\[|\\]", replacement = "")
# Create taxmap object
output <- extract_tax_data(tax_data = headers,
regex = "^(.*)\\.([0-9]*)\\.([0-9]*) (.*)$",
key = c(ncbi_id = "info",
start_pos = "info",
end_pos = "info",
tax_string = "class"),
class_regex = paste0("^([", name_chars, "]+) ?\\(?([", name_chars, "]*)\\)?$"),
class_key = c("name" = "taxon_name", other_name = "info"),
class_sep = ";")
# Clean up taxon names
output$taxa <- lapply(output$taxa, function(x) {
x$name$name <- sub(pattern = " $", replacement = "", x$name$name)
x$name$name <- sub(pattern = "_", replacement = " ", x$name$name) # undo the sp._xxx hack above
return(x)
})
# Add sequences
if (include_seqs) {
output$data$tax_data$silva_seq <- raw_data
}
# Remove unneeded columns
# output$data$tax_data$input <- NULL
output$data$tax_data$tax_string <- NULL
# Filter uninformative rows in class_data
output$data$class_data <- output$data$class_data[output$data$class_data$other_name != "", ]
output$data$class_data$name <- trimws(output$data$class_data$name)
return(output)
}
#' Parse Greengenes release
#'
#' Parses the greengenes database.
#'
#' The taxonomy input file has a format like:
#'
#' \preformatted{
#' 228054 k__Bacteria; p__Cyanobacteria; c__Synechococcophycideae; o__Synech...
#' 844608 k__Bacteria; p__Cyanobacteria; c__Synechococcophycideae; o__Synech...
#' ...
#' }
#'
#' The optional sequence file has a format like:
#'
#' \preformatted{
#' >1111886
#' AACGAACGCTGGCGGCATGCCTAACACATGCAAGTCGAACGAGACCTTCGGGTCTAGTGGCGCACGGGTGCGTA...
#' >1111885
#' AGAGTTTGATCCTGGCTCAGAATGAACGCTGGCGGCGTGCCTAACACATGCAAGTCGTACGAGAAATCCCGAGC...
#' ...
#' }
#'
#' @param tax_file (\code{character} of length 1) The file path to the
#' greengenes taxonomy file.
#' @param seq_file (\code{character} of length 1) The file path to the
#' greengenes sequence fasta file. This is optional.
#'
#' @return \code{\link{taxmap}}
#'
#' @family parsers
#'
#' @export
parse_greengenes <- function(tax_file, seq_file = NULL) {
# Parse taxonomy file
tax_data <- utils::read.table(tax_file, sep = "\t")
colnames(tax_data) <- c("gg_id", "classification")
result <- parse_tax_data(tax_data, class_cols = "classification",
class_sep = "; ",
class_regex = "^([a-z]{1})__(.*)$",
class_key = c("gg_rank" = "info", "name" = "taxon_name"))
result$data$tax_data$gg_id <- as.character(result$data$tax_data$gg_id)
# Remove data for ranks with no information
result <- result$filter_taxa(result$taxon_names() != "", drop_obs = TRUE,
reassign_obs = c(tax_data = TRUE, class_data = FALSE))
# Integrating sequence and taxonomy
if (! is.null(seq_file)) {
gg_sequences <- seqinr::read.fasta(seq_file, as.string = TRUE)
result <- result$mutate_obs("tax_data", gg_seq = toupper(unlist(gg_sequences)[result$data$tax_data$gg_id]))
}
return(result)
}
#' Parse a phylo object
#'
#' Parses a phylo object from the ape package.
#'
#' @param obj A phylo object from the ape package.
#'
#' @return \code{\link{taxmap}}
#'
#' @family parsers
#'
#' @export
parse_phylo <- function(obj) {
# Parse edge list
edge_list <- as.data.frame(obj$edge)
colnames(edge_list) <- c("from", "to")
edge_list$from <- as.character(edge_list$from)
edge_list$to <- as.character(edge_list$to)
# Add roots to edge list
is_root <- vapply(seq_len(nrow(edge_list)),
function(i) ! edge_list$from[i] %in% edge_list$to,
FUN.VALUE = logical(1))
roots <- unique(edge_list$from[is_root])
edge_list <- rbind(data.frame(from = NA, to = roots), edge_list)
# Parse edge length
edge_length <- rep(NA, nrow(edge_list))
edge_length[!is.na(edge_list$from)] <- obj$edge.length
# Parse tip labels
is_tip <- vapply(seq_len(nrow(edge_list)),
function(i) ! edge_list$to[i] %in% edge_list$from,
FUN.VALUE = logical(1))
tip_label <- rep(NA, nrow(edge_list))
tip_label[is_tip] <- obj$tip.label
# Build taxmap object
output <- taxmap()
output$edge_list <- edge_list
taxon_ids <- unique(unlist(output$edge_list))
taxon_ids <- taxon_ids[!is.na(taxon_ids)]
output$taxa <- stats::setNames(lapply(paste0("node_", taxon_ids), taxon),
taxon_ids)
tax_data <- tibble::as_tibble(data.frame(stringsAsFactors = FALSE,
taxon_id = edge_list$to,
edge_length = edge_length,
tip_label = tip_label))
output$data <- c(output$data, list(tax_data = tax_data))
output$replace_taxon_ids(convert_base(as.integer(output$taxon_ids())))
}
#' Converts the uBiome file format to taxmap
#'
#' Converts the uBiome file format to taxmap. NOTE: This is experimental and might not work if
#' uBiome changes their format. Contact the maintainers if you encounter problems/
#'
#' The input file has a format like:
#'
#' \preformatted{
#' tax_name,tax_rank,count,count_norm,taxon,parent
#' root,root,29393,1011911,1,
#' Bacteria,superkingdom,29047,1000000,2,131567
#' Campylobacter,genus,23,791,194,72294
#' Flavobacterium,genus,264,9088,237,49546
#' }
#'
#' @param file (\code{character} of length 1) The file path to the input file.
#' Either "file", or "table" must be used, but only one.
#' @param table (\code{character} of length 1) An already parsed data.frame or
#' tibble. Either "file", or "table" must be used, but only one.
#'
#' @return \code{\link{taxmap}}
#'
#' @family parsers
#'
#' @export
parse_ubiome <- function(file = NULL, table = NULL) {
# Check that `file` and `text` and `table` are not used together
are_missing <- c(file = is.null(file),
text = is.null(table))
if (sum(are_missing) != 1) {
stop(paste0('Either "file" or "table" must be supplied, but not both.'))
}
# Read raw data
if (is.null(file)) {
raw_data <- table
} else {
raw_data <- readr::read_csv(file)
}
# Make taxmap object
output <- parse_edge_list(input = raw_data,
taxon_id = "taxon",
supertaxon_id = "parent",
taxon_name = "tax_name",
taxon_rank = "tax_rank")
return(output)
}
#' Convert a table with an edge list to taxmap
#'
#' Converts a table containing an edge list into a [taxmap()] object.
#' An "edge list" is two columns in a table, where each row defines a taxon-supertaxon relationship.
#' The contents of the edge list will be used as taxon IDs.
#' The whole table will be included as a data set in the output object.
#'
#' @param input A table containing an edge list encoded by two columns.
#' @param taxon_id The name/index of the column containing the taxon IDs.
#' @param supertaxon_id The name/index of the column containing the taxon IDs for the supertaxon of the IDs in `taxon_col`.
#'
#' @family parsers
#'
#' @keywords internal
parse_edge_list <- function(input, taxon_id, supertaxon_id, taxon_name, taxon_rank = NULL) {
# Create empty taxmap object
output <- taxmap()
# Make taxon ID characters
input[taxon_id] <- as.character(input[[taxon_id]])
input[supertaxon_id] <- as.character(input[[supertaxon_id]])
# Add edge list
output$edge_list <- data.frame(from = input[[supertaxon_id]],
to = input[[taxon_id]],
stringsAsFactors = FALSE)
# Add taxa
output$taxa <- lapply(seq_len(nrow(input)), function(i) {
my_name <- input[[taxon_name]][i]
if (is.null(taxon_rank)) {
my_rank <- NULL
} else {
my_rank <- input[[taxon_rank]][i]
}
my_id <- input[[taxon_id]][i]
taxon(name = my_name, rank = my_rank, id = my_id)
})
names(output$taxa) <- input[[taxon_id]]
# Add data
input <- dplyr::mutate(input, taxon_id = taxon_ids(output))
input <- dplyr::select(input, taxon_id, everything())
output$data <- list(input = input)
return(output)
}
#' Convert the output of dada2 to a taxmap object
#'
#' Convert the ASV table and taxonomy table returned by dada2 into a taxmap object. An example of
#' the input format can be found by following the dada2 tutorial here:
#' shttps://benjjneb.github.io/dada2/tutorial.html
#'
#' @param seq_table The ASV abundance matrix, with rows as samples and columns as ASV ids or
#' sequences
#' @param tax_table The table with taxonomic classifications for ASVs, with ASVs in rows and
#' taxonomic ranks as columns.
#' @inheritParams parse_tax_data
#'
#' @return \code{\link{taxmap}}
#'
#' @family parsers
#'
#' @export
parse_dada2 <- function(seq_table, tax_table, class_key = "taxon_name", class_regex = "(.*)", include_match = TRUE) {
# Convert sequence table to tibble
seq_table <- t(seq_table)
seq_table <- dplyr::bind_cols(asv_id = rownames(seq_table), dplyr::as_tibble(seq_table))
# Convert taxonomy table to tibble
tax_table <- dplyr::as_tibble(cbind(asv_id = rownames(tax_table), tax_table))
# Convert to taxmap format
output <- parse_tax_data(tax_table,
class_cols = -1,
named_by_rank = TRUE,
class_key = class_key,
class_regex = class_regex,
include_match = include_match,
include_tax_data = FALSE,
datasets = list(asv_table = seq_table),
mappings = c("asv_id" = "asv_id"))
# Remove NA taxa
output$filter_taxa(!is.na(taxon_names))
return(output)
}
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.