evenlyScaleEnsemble: Evenly scale an ensemble of spectra such that their
In mathornton01/Genomic-DFT-Yin-R: Fourier Analysis for Genomic Signals
View source: R/Yin-DFT-Distances-R.r
Description
This function will take an ensemble of genomic power spectra, and scale them
all such that they are of a length equivalent to the maximum length of a
sequence in the ensemble.
@param spectraList A list containing the power spectra of genomic signals
for sequences of interest.
@return A list of scaled spectra all of which should be the same length.
@examples
tg <- c("ACCCAAGAGAGAGCCCCCGAGAGAGAGAGAGAGAGCCCCGAGAGAGCGAGACGAGAC","TAGAGCCGAGATAGAGCCGAGAGTTAGAC","CGGAGAGNNGGAGAGCCCGAGAGTTTGAGNN")
eg <- encodeGenomes(tg);
ps <- getPowerSpectraEnsemble(eg);
sps <- evenlyScaleEnsemble(ps);
@export
Usage
1
evenlyScaleEnsemble(spectraList)
mathornton01/Genomic-DFT-Yin-R documentation built on Dec. 21, 2021, 2:52 p.m.
R Package Documentation
Browse R Packages
We want your feedback!
Note that we can't provide technical support on individual packages. You should contact the package authors for that.
View source: R/Yin-DFT-Distances-R.r
Description
This function will take an ensemble of genomic power spectra, and scale them all such that they are of a length equivalent to the maximum length of a sequence in the ensemble. @param spectraList A list containing the power spectra of genomic signals for sequences of interest. @return A list of scaled spectra all of which should be the same length. @examples tg <- c("ACCCAAGAGAGAGCCCCCGAGAGAGAGAGAGAGAGCCCCGAGAGAGCGAGACGAGAC","TAGAGCCGAGATAGAGCCGAGAGTTAGAC","CGGAGAGNNGGAGAGCCCGAGAGTTTGAGNN") eg <- encodeGenomes(tg); ps <- getPowerSpectraEnsemble(eg); sps <- evenlyScaleEnsemble(ps); @export
Usage
1 | evenlyScaleEnsemble(spectraList)
|
R Package Documentation
Browse R Packages
We want your feedback!
Note that we can't provide technical support on individual packages. You should contact the package authors for that.
Embedding an R snippet on your website
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.