RE_collection: p53 retriever results on a set of human promoters

In tomateba/p53retriever: detection and display of p53 putative response elements (REs) on DNA sequences

Description

A dataset containing all p53 REs found by p53retreiever on a set of 253 human promoters, to be used as an exemplary dataframe to test p53retriever functionalities

Usage

data(RE_collection)

Format

An object of class data.frame with 3062 rows and 17 variables:

• HGNC: gene symbol (e.g. TP73)

• ID: sequence ID (e.g. uc001akp.3)

• chr: chromosome (e.g. chr1)

• chr: strand (e.g. +)

• hg19.TSS: hg19 genomic coordinate of the TSS (e.g. 3569128)

• hg19.start: hg19 genomic coordinate of the RE's start (e.g. 3559376)

• hg19.stop: hg19 genomic coordinate of the RE's stop (e.g. 3559405)

• start: relative coordinate of the RE's start with respect to the TSS (e.g. -9752)

• stop: relative coordinate of the RE's stop with respect to the TSS (e.g. -9723)

• spacer: spacer length of the RE (e.g. 10)

• WW1: sequence of WW1 in the RE (e.g. CT)

• WW2: sequence of WW2 in the RE (e.g. AT)

• n.mismatch: number of mismatches with respect to the canonical p53 RE (e.g. 2)

• mismatch.string: string encoding the position of mismatches in the RE with respect to the canonical one (0 = match, 1 = mismatch, n= spacer, e.g. 0000100000nnnnnnnnnn0000000010)

• sequence: RE sequence (including the spacer, e.g. gaacctgcttcatttaaatggagcatgtgt)

• label: mismatch label assigned to the RE by p53retriever, according to the number, the nature and the position of mismatches (0 = no mismatches, A = mismatch in C or G positions, B = mismatch in W positions, C = mismatch in R or Y "external" positions, D = mismatch in R or Y "internal" positions, 3Q = three-quarter site, half = half site)

• grade: functional score assigned to the RE by p53retriever, according to the number, the nature and the position of mismatches (5 = high, 4 = moderate, 3 = slight, 2 = poor, 1= unlikely)

tomateba/p53retriever documentation built on May 31, 2019, 6:10 p.m.