p53track: Function p53.track

In tomateba/p53retriever: detection and display of p53 putative response elements (REs) on DNA sequences

Description

This function locates candidate p53 responsive elements on a DNA sequence. The rules formalized in this model are manually curated and based on observations obtained during several years of experiments using the yeast-based assays, including the results presented in (Inga et al, MCB 2002; Tomso et al, PNAS 2005; Jegga et al, PNAS 2008; Jordan et al, PloS Genetics 2008; Menendez et al, PNAS 2010).

Usage

p53track(seq, seqname = "")

Arguments

seq	A character string containing the sequence. The sequence must be composed exclusively of DNA bases (a,c,t,g)
seqname	A character string containing the name of the sequence. The default is an empty string.

Value

An object of class data.frame containing one row for each responsive elements located on the input sequence. For each element, the following infomation is provided: #'

• ID: sequence ID (e.g. CDKN1A)

• start: coordinate of the RE's start with respect to the input sequence (e.g. 246)

• stop: relative coordinate of the RE's stop with respect to the input sequence (e.g. 266)

• spacer: spacer length of the RE (e.g. 10)

• n.mismatches: number of mismatches with respect to the canonical p53 RE (e.g. 2)

• sequence: RE sequence (including the spacer, e.g. gaacctgcttcatttaaatggagcatgtgt)

• mismatch.string: string encoding the position of mismatches in the RE with respect to the canonical one (0 = match, 1 = mismatch, n= spacer, e.g. 0000100000nnnnnnnnnn0000000010)

• WW1: sequence of WW1 in the RE (e.g. CT)

• WW2: sequence of WW2 in the RE (e.g. AT)

• label: mismatch label assigned to the RE by p53retriever, according to the number, the nature and the position of mismatches (0 = no mismatches, A = mismatch in C or G positions, B = mismatch in W positions, C = mismatch in R or Y "external" positions, D = mismatch in R or Y "internal" positions, 3Q = three-quarter site, half = half site)

• grade: functional score assigned to the RE by p53retriever, according to the number, the nature and the position of mismatches (5 = high, 4 = moderate, 3 = slight, 2 = poor, 1= unlikely)

Examples

data(CDKN1A)
p53track(CDKN1A,seqname="CDKN1A")

tomateba/p53retriever documentation built on May 31, 2019, 6:10 p.m.