Description Usage Arguments Value Examples
This function locates candidate p53 responsive elements on a DNA sequence. The rules formalized in this model are manually curated and based on observations obtained during several years of experiments using the yeast-based assays, including the results presented in (Inga et al, MCB 2002; Tomso et al, PNAS 2005; Jegga et al, PNAS 2008; Jordan et al, PloS Genetics 2008; Menendez et al, PNAS 2010).
1 |
seq |
A character string containing the sequence. The sequence must be composed exclusively of DNA bases (a,c,t,g) |
seqname |
A character string containing the name of the sequence. The default is an empty string. |
An object of class data.frame containing one row for each responsive elements located on the input sequence. For each element, the following infomation is provided:
#'
ID: sequence ID (e.g. CDKN1A)
start: coordinate of the RE's start with respect to the input sequence (e.g. 246)
stop: relative coordinate of the RE's stop with respect to the input sequence (e.g. 266)
spacer: spacer length of the RE (e.g. 10)
n.mismatches: number of mismatches with respect to the canonical p53 RE (e.g. 2)
sequence: RE sequence (including the spacer, e.g. gaacctgcttcatttaaatggagcatgtgt)
mismatch.string: string encoding the position of mismatches in the RE with respect to the canonical one (0 = match, 1 = mismatch, n= spacer, e.g. 0000100000nnnnnnnnnn0000000010)
WW1: sequence of WW1 in the RE (e.g. CT)
WW2: sequence of WW2 in the RE (e.g. AT)
label: mismatch label assigned to the RE by p53retriever, according to the number, the nature and the position of mismatches (0 = no mismatches, A = mismatch in C or G positions, B = mismatch in W positions, C = mismatch in R or Y "external" positions, D = mismatch in R or Y "internal" positions, 3Q = three-quarter site, half = half site)
grade: functional score assigned to the RE by p53retriever, according to the number, the nature and the position of mismatches (5 = high, 4 = moderate, 3 = slight, 2 = poor, 1= unlikely)
1 2 |
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.