compare2Sequences: Compare 2 input sequences/sequence sets for possible guide...

In CRISPRseek: Design of target-specific guide RNAs in CRISPR-Cas9, genome-editing systems

Description

Generate all possible guide RNAs (gRNAs) for two input sequences, or two sets of sequences and generate scores for potential off-targets in the other sequence.

Usage

compare2Sequences(inputFile1Path, inputFile2Path, 
    inputNames=c("Seq1", "Seq2"), 
    format = c("fasta", "fasta"), header=FALSE, findgRNAsWithREcutOnly = FALSE, 
    searchDirection=c("both","1to2", "2to1"), BSgenomeName,
    baseEditing = FALSE, targetBase = "C", editingWindow = 4:8,
    editingWindow.offtargets = 4:8,
    REpatternFile=system.file("extdata", "NEBenzymes.fa", package = "CRISPRseek"),
    minREpatternSize = 6, findgRNAs = c(TRUE, TRUE), removegRNADetails = c(FALSE, FALSE),
    exportAllgRNAs = c("no", "all", "fasta", "genbank"), annotatePaired =  FALSE,
    overlap.gRNA.positions = c(17, 18), findPairedgRNAOnly = FALSE, 
    min.gap = 0, max.gap = 20, gRNA.name.prefix = "_gR", PAM.size = 3, 
    gRNA.size = 20, PAM = "NGG", PAM.pattern = "NNG$|NGN$",
    allowed.mismatch.PAM = 1, max.mismatch = 3,
    outputDir, upstream = 0, downstream = 0, 
    weights = c(0, 0, 0.014, 0, 0, 0.395, 0.317, 0, 0.389, 0.079, 0.445,
    0.508, 0.613, 0.851, 0.732, 0.828, 0.615, 0.804, 0.685, 0.583), 
    overwrite = FALSE, baseBeforegRNA = 4, 
    baseAfterPAM = 3, featureWeightMatrixFile = system.file("extdata", 
       "DoenchNBT2014.csv", package = "CRISPRseek"), foldgRNAs = FALSE, 
    gRNA.backbone = 
"GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUU",
    temperature = 37,
    scoring.method = c("Hsu-Zhang", "CFDscore"),
        subPAM.activity = hash( AA =0,
          AC =   0,
          AG = 0.259259259,
          AT = 0,
          CA = 0,
          CC = 0,
          CG = 0.107142857,
          CT = 0,
          GA = 0.069444444,
          GC = 0.022222222,
          GG = 1,
          GT = 0.016129032,
          TA = 0,
          TC = 0,
          TG = 0.038961039,
          TT = 0),
     subPAM.position = c(22, 23),
     PAM.location = "3prime",
     rule.set = c("Root_RuleSet1_2014", "Root_RuleSet2_2016"), mismatch.activity.file = system.file("extdata",
         "NatureBiot2016SuppTable19DoenchRoot.csv",
         package = "CRISPRseek")    
    )

Arguments

inputFile1Path	Sequence input file 1 path that contains one of the two sequences to be searched for potential gRNAs. It can also be a DNAStringSet object with names field set. Please see examples below.
inputFile2Path	Sequence input file 2 path that contains one of the two sequences to be searched for potential gRNAs. It can also be a DNAStringSet object with names field set. Please see examples below.
inputNames	Name of the input sequences when inputFile1Path and inputFile2Path are DNAStringSet instead of file path
format	Format of the input files, fasta, fastq and bed format are supported, default fasta
header	Indicate whether the input file contains header, default FALSE, only applies to bed format
findgRNAsWithREcutOnly	Indicate whether to find gRNAs overlap with restriction enzyme recognition pattern
searchDirection	Indicate whether perfrom gRNA in both sequences and off-target search against each other (both) or search gRNA in input1 and off-target analysis in input2 (1to2), or vice versa (2to1)
BSgenomeName	BSgenome object. Please refer to available.genomes in BSgenome package. For example, BSgenome.Hsapiens.UCSC.hg19 for hg19, BSgenome.Mmusculus.UCSC.mm10 for mm10, BSgenome.Celegans.UCSC.ce6 for ce6, BSgenome.Rnorvegicus.UCSC.rn5 for rn5, BSgenome.Drerio.UCSC.danRer7 for Zv9, and BSgenome.Dmelanogaster.UCSC.dm3 for dm3
baseEditing	Indicate whether to design gRNAs for base editing. Default to FALSE If TRUE, please set baseEditing = TRUE, targetBase and editingWidow accordingly.
targetBase	Applicable only when baseEditing is set to TRUE. It is used to indicate the target base for base editing systems, default to C for converting C to T in the CBE system. Please change it to A if you intend to use the ABE system.
editingWindow	Applicable only when baseEditing is set to TRUE. It is used to indicate the effective editing window, default to 4 to 8 which is for the original CBE system. Please change it accordingly if the system you use have a different editing window.
editingWindow.offtargets	Applicable only when baseEditing is set to TRUE. It is used to indicate the effective editing window to consider for the offtargets search only, default to 4 to 8 which is for the original CBE system. Please change it accordingly if the system you use have a different editing window, or you would like to include offtargets with the target base in a larger editing window.
REpatternFile	File path containing restriction enzyme cut patters
minREpatternSize	Minimum restriction enzyme recognition pattern length required for the enzyme pattern to be searched for, default 6
findgRNAs	Indicate whether to find gRNAs from the sequences in the input file or skip the step of finding gRNAs, default TRUE for both input sequences. Set it to FALSE if the input file contains user selected gRNAs plus PAM already.
removegRNADetails	Indicate whether to remove the detailed gRNA information such as efficacy file and restriction enzyme cut sites, default false for both input sequences. Set it to TRUE if the input file contains the user selected gRNAs plus PAM already.
exportAllgRNAs	Indicate whether to output all potential gRNAs to a file in fasta format, genbank format or both. Default to no.
annotatePaired	Indicate whether to output paired information, default to FALSE
overlap.gRNA.positions	The required overlap positions of gRNA and restriction enzyme cut site, default 17 and 18
findPairedgRNAOnly	Choose whether to only search for paired gRNAs in such an orientation that the first one is on minus strand called reverse gRNA and the second one is on plus strand called forward gRNA. TRUE or FALSE, default FALSE
min.gap	Minimum distance between two oppositely oriented gRNAs to be valid paired gRNAs. Default 0
max.gap	Maximum distance between two oppositely oriented gRNAs to be valid paired gRNAs. Default 20
gRNA.name.prefix	The prefix used when assign name to found gRNAs, default _gR, short for guided RNA.
PAM.size	PAM length, default 3
gRNA.size	The size of the gRNA, default 20
PAM	PAM sequence after the gRNA, default NGG
PAM.pattern	Regular expression of PAM, default NNG or NGN for spCas9. For cpf1, ^TTTN since it is a 5 prime PAM sequence
allowed.mismatch.PAM	Maximum number of mismatches allowed to the PAM sequence, default to 1 for PAM.pattern NNG or NGN PAM
max.mismatch	Maximum mismatch allowed to search the off targets in the other sequence, default 3
outputDir	the directory where the sequence comparison results will be written to
upstream	upstream offset from the bed input starts to search for gRNA and/or offtargets, default 0
downstream	downstream offset from the bed input ends to search for gRNA and/or offtargets, default 0
weights	numeric vector size of gRNA length, default c(0, 0, 0.014, 0, 0, 0.395, 0.317, 0, 0.389, 0.079, 0.445, 0.508, 0.613, 0.851, 0.732, 0.828, 0.615, 0.804, 0.685, 0.583) which is used in Hsu et al., 2013 cited in the reference section
overwrite	overwrite the existing files in the output directory or not, default TRUE
baseBeforegRNA	Number of bases before gRNA used for calculating gRNA efficiency, default 4 Please note, for PAM located on the 5 prime, need to specify the number of bases before the PAM sequence plus PAM size.
baseAfterPAM	Number of bases after PAM used for calculating gRNA efficiency, default 3 for spCas9 Please note, for PAM located on the 5 prime, need to include the length of the gRNA plus the extended sequence on the 3 prime
featureWeightMatrixFile	Feature weight matrix file used for calculating gRNA efficiency. By default DoenchNBT2014 weight matrix is used. To use alternative weight matrix file, please input a csv file with first column containing significant features and the second column containing the corresponding weights for the features. Please see Doench et al., 2014 for details.
foldgRNAs	Default FALSE. If set to TRUE, summary file will contain minimum free energy of the secondary structure of gRNA with gRNA backbone from GeneRfold package provided that GeneRfold package has been installed.
gRNA.backbone	gRNA backbone constant region sequence. Default to the sequence in Sp gRNA backbone.
temperature	temperature in celsius. Default to 37 celsius.
scoring.method	Indicates which method to use for offtarget cleavage rate estimation, currently two methods are supported, Hsu-Zhang and CFDscore
subPAM.activity	Applicable only when scoring.method is set to CFDscore A hash to represent the cleavage rate for each alternative sub PAM sequence relative to preferred PAM sequence
subPAM.position	Applicable only when scoring.method is set to CFDscore The start and end positions of the sub PAM. Default to 22 and 23 for SP with 20bp gRNA and NGG as preferred PAM
PAM.location	PAM location relative to gRNA. For example, spCas9 PAM is located on the 3 prime (3prime) while cpf1 PAM is located on the 5 prime (5prime)
rule.set	Specify a rule set scoring system for calculating gRNA efficacy. Please note that Root_RuleSet2_2016 requires the following python packages with specified verion and python 2.7. 1. scikit-learn 0.16.1 2. pickle 3. pandas 4. numpy 5. scipy
mismatch.activity.file	Applicable only when scoring.method is set to CFDscore A comma separated (csv) file containing the cleavage rates for all possible types of single nucleotide mismatche at each position of the gRNA. By default, using the supplemental Table 19 from Doench et al., Nature Biotechnology 2016

Value

Return a data frame with all potential gRNAs from both sequences. In addition, a tab delimited file scoresFor2InputSequences.xls is also saved in the outputDir, sorted by scoreDiff descending.

name	name of the gRNA
gRNAPlusPAM	gRNA plus PAM sequence
targetInSeq1	target/off-target sequence including PAM in the 1st input sequence file
targetInSeq2	target/off-target sequence incuding PAM in the 2nd input sequence file
guideAlignment2Offtarget	alignment of gRNA to the other input sequence (off-target sequence)
offTargetStrand	strand of the other sequence (off-target sequence) the gRNA align to
scoreForSeq1	score for the target sequence in the 1st input sequence file
scoreForSeq2	score for the target sequence in the 1st input sequence file
mismatch.distance2PAM	distances of mismatch to PAM, e.g., 14 means the mismatch is 14 bp away from PAM
n.mismatch	number of mismatches between the off-target and the gRNA
targetSeqName	the name of the input sequence where the target sequence is located
scoreDiff	scoreForSeq1 - scoreForSeq2
bracket.notation	folded gRNA in bracket notation
mfe.sgRNA	minimum free energy of sgRNA
mfe.diff	mfe.sgRNA-mfe.backbone
mfe.backbone	minimum free energy of the gRNA backbone by itself

Author(s)

Lihua Julie Zhu

References

Patrick D Hsu, David A Scott, Joshua A Weinstein, F Ann Ran, Silvana Konermann, Vineeta Agarwala, Yinqing Li, Eli J Fine, Xuebing Wu, Ophir Shalem, Thomas J Cradick, Luciano A Marraffini, Gang Bao & Feng Zhang (2013) DNA targeting specificity of rNA-guided Cas9 nucleases. Nature Biotechnology 31:827-834

See Also

CRISPRseek

Examples

    library(CRISPRseek)
    inputFile1Path <- system.file("extdata", "rs362331T.fa",
            package = "CRISPRseek")
    inputFile2Path <- system.file("extdata", "rs362331C.fa",
            package = "CRISPRseek")
    REpatternFile <- system.file("extdata", "NEBenzymes.fa", 
            package = "CRISPRseek")
    seqs <- compare2Sequences(inputFile1Path, inputFile2Path,
        outputDir = getwd(), 
        REpatternFile = REpatternFile, overwrite = TRUE)

    seqs2 <- compare2Sequences(inputFile1Path, inputFile2Path,
               inputNames=c("Seq1", "Seq2"),
               scoring.method = "CFDscore",
               outputDir = getwd(), 
               overwrite = TRUE, baseEditing = TRUE)

    inputFile1Path <- 
DNAStringSet(
"TAATATTTTAAAATCGGTGACGTGGGCCCAAAACGAGTGCAGTTCCAAAGGCACCCACCTGTGGCAG"
)
    ## when set inputFile1Path to a DNAStringSet object, it is important
    ## to call names
    names(inputFile1Path) <- "seq1"
    
    inputFile2Path <- 
DNAStringSet(
"TAATATTTTAAAATCGGTGACGTGGGCCCAAAACGAGTGCAGTTCCAAAGGCACCCACCTGTGGCAG"
)
     ## when set inputFile2Path to a DNAStringSet object, it is important 
    ## to call names

    names(inputFile2Path) <- "seq2"

    seqs <- compare2Sequences(inputFile1Path, inputFile2Path,
          inputNames=c("Seq1", "Seq2"),
          scoring.method = "CFDscore",
          outputDir = getwd(), 
          overwrite = TRUE)

    seqs2 <- compare2Sequences(inputFile1Path, inputFile2Path,
               inputNames=c("Seq1", "Seq2"),
               scoring.method = "CFDscore",
               outputDir = getwd(), 
               overwrite = TRUE, baseEditing = TRUE)

CRISPRseek documentation built on Jan. 14, 2021, 2:50 a.m.