Description Usage Arguments Details Value Author(s) Examples
This function generates random DNA sequences, nucleotides are sampled with frequency 0.25 each.
1 | randDNA(n)
|
n |
The length of the sequence desired. |
This function generates random sequences of A, C, T and G. Real DNA is quite different, so one should not use these sequences for much other than pedagogical purposes.
A length one character vector, with n characters randomly
chosen from A, C, T and G.
R. Gentleman
1 | randDNA(100)
|
Loading required package: graph
Loading required package: BiocGenerics
Loading required package: parallel
Attaching package: 'BiocGenerics'
The following objects are masked from 'package:parallel':
clusterApply, clusterApplyLB, clusterCall, clusterEvalQ,
clusterExport, clusterMap, parApply, parCapply, parLapply,
parLapplyLB, parRapply, parSapply, parSapplyLB
The following objects are masked from 'package:stats':
IQR, mad, sd, var, xtabs
The following objects are masked from 'package:base':
Filter, Find, Map, Position, Reduce, anyDuplicated, append,
as.data.frame, cbind, colMeans, colSums, colnames, do.call,
duplicated, eval, evalq, get, grep, grepl, intersect, is.unsorted,
lapply, lengths, mapply, match, mget, order, paste, pmax, pmax.int,
pmin, pmin.int, rank, rbind, rowMeans, rowSums, rownames, sapply,
setdiff, sort, table, tapply, union, unique, unsplit, which,
which.max, which.min
[1] "CTGGATGATATGGTTGTATAATAAGCCGGTCTGACAAGCTCCCCCTCTGCTGCGGTTTCCCGGAGATTGTTTACGTCCGCGTTACCAAGCTGACAACATT"
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.