rfastp: R wrap of fastp

In Rfastp: An Ultra-Fast and All-in-One Fastq Preprocessor (Quality Control, Adapter, low quality and polyX trimming) and UMI Sequence Parsing).

Description

Quality control (Cut adapter, low quality trimming, polyX trimming, UMI handling, and etc.) of fastq files.

Usage

rfastp(
  read1,
  read2 = "",
  outputFastq,
  unpaired = "",
  failedOut = "",
  merge = FALSE,
  mergeOut = "",
  phred64 = FALSE,
  interleaved = FALSE,
  fixMGIid = FALSE,
  adapterTrimming = TRUE,
  adapterSequenceRead1 = "auto",
  adapterSequenceRead2 = "auto",
  adapterFasta = "",
  trimFrontRead1 = 0,
  trimTailRead1 = 0,
  trimFrontRead2 = 0,
  trimTailRead2 = 0,
  maxLengthRead1 = 0,
  maxLengthRead2 = 0,
  forceTrimPolyG = FALSE,
  disableTrimPolyG = FALSE,
  minLengthPolyG = 10,
  trimPolyX = FALSE,
  minLengthPolyX = 10,
  cutWindowSize = 4,
  cutLowQualTail = FALSE,
  cutSlideWindowRight = FALSE,
  cutLowQualFront = FALSE,
  cutMeanQual = 20,
  cutFrontWindowSize = 4,
  cutFrontMeanQual = 20,
  cutTailWindowSize = 4,
  cutTailMeanQual = 20,
  cutSlideWindowSize = 4,
  cutSlideWindowQual = 20,
  qualityFiltering = TRUE,
  qualityFilterPhred = 15,
  qualityFilterPercent = 40,
  maxNfilter = 5,
  averageQualFilter = 0,
  lengthFiltering = TRUE,
  minReadLength = 15,
  maxReadLength = 0,
  lowComplexityFiltering = FALSE,
  minComplexity = 30,
  index1Filter = "",
  index2Filter = "",
  maxIndexMismatch = 0,
  correctionOverlap = FALSE,
  minOverlapLength = 30,
  maxOverlapMismatch = 5,
  maxOverlapMismatchPercentage = 20,
  umi = FALSE,
  umiLoc = "",
  umiLength = 0,
  umiPrefix = "",
  umiSkipBaseLength = 0,
  umiNoConnection = FALSE,
  umiIgnoreSeqNameSpace = FALSE,
  overrepresentationAnalysis = FALSE,
  overrepresentationSampling = 20,
  splitOutput = 0,
  splitByLines = 0,
  thread = 2,
  verbose = TRUE
)

Arguments

read1	read1 input file name(s). [vector]
read2	read2 input file name(s). [vector]
outputFastq	string of /path/prefix for output fastq [string]
unpaired	for PE input, output file name for reads which the mate reads failed to pass the QC [string], default NULL, discard it. [string]
failedOut	file to store reads that cannot pass the filters default NULL, discard it. [string]
merge	for PE input, A logical(1) indicating whether merge each pair of reads into a single read if they are overlaped, unmerged reads will be write to 'output' file. Default is FALSE. the 'mergeOut' must be set if TRUE.
mergeOut	under 'merge' mode, file to store the merged reads. [string]
phred64	A logical indicating whether the input is using phred64 scoring (it will be converted to phred33, so the output will still be . phred33)
interleaved	A logical indicating whether <read1> is an interleaved FASTQ which contains both read1 and read2. Default is FALSE.
fixMGIid	the MGI FASTQ ID format is not compatible with many BAM operation tools, enable this option to fix it. Default is FALSE
adapterTrimming	A logical indicating whether run adapter trimming. Default is 'TRUE'
adapterSequenceRead1	the adapter for read1. For SE data, if not specified, the adapter will be auto-detected. For PE data, this is used if R1/R2 are found not overlapped.
adapterSequenceRead2	the adapter for read2 (PE data only). This is used if R1/R2 are found not overlapped. If not specified, it will be the same as <adapterSequenceRead1>
adapterFasta	specify a FASTA file to trim both read1 and read2 (if PE) by all the sequences in this FASTA file.
trimFrontRead1	trimming how many bases in front for read1, default is 0.
trimTailRead1	trimming how many bases in tail for read1, default is 0'
trimFrontRead2	trimming how many bases in front for read2. If it's not specified, it will follow read1's settings
trimTailRead2	trimming how many bases in tail for read2. If it's not specified, it will follow read1's settings
maxLengthRead1	if read1 is longer than maxLengthRead1, then trim read1 at its tail to make it as long as maxLengthRead1 Default 0 means no limitation.
maxLengthRead2	if read2 is longer than maxLengthRead2, then trim read2 at its tail to make it as long as maxLengthRead2. Default 0 means no limitation. If it's not specified, it will follow read1's settings.
forceTrimPolyG	A logical indicating force polyG tail trimming, trimming is only automatically enabled for Illumina NextSeq/NovaSeq . data.
disableTrimPolyG	A logical indicating disable polyG tail trimming.
minLengthPolyG	the minimum length to detect polyG in the read tail. 10 by default.
trimPolyX	A logical indicating force polyX tail trimming.
minLengthPolyX	the minimum length to detect polyX in the read tail. 10 by default.
cutWindowSize	the window size option shared by cutLowQualFront, cutLowQualTail, or cutSlideWindowRight. Range: 1~1000, default: 4
cutLowQualTail	A logical indiccating move a sliding window from tail (3') to front, drop the bases in the window if its mean quality < threshold, stop otherwise. Default is 'FALSE'
cutSlideWindowRight	A logical indicating move a sliding window from front to tail, if meet one window with mean quality < threshold, drop the bases in the window and the right part, and then stop. Default is 'FALSE'
cutLowQualFront	A logical indiccating move a sliding window from front (5') to tail, drop the bases in the window if its mean quality < threshold, stop otherwise. Default is 'FALSE'
cutMeanQual	the mean quality requirement option shared by cutLowQualFront, cutLowQualTail or cutSlideWindowRight. Range: 1~36, default: 20
cutFrontWindowSize	the window size option of cutLowQualFront, default to cutWindowSize if not specified. default: 4
cutFrontMeanQual	the mean quality requirement option for cutLowQualFront, default to cutMeanQual if not specified. default: 20
cutTailWindowSize	the window size option of cutLowQualTail, default to cutWindowSize if not specified. default: 4
cutTailMeanQual	the mean quality requirement option for cutLowQualTail, default to cutMeanQual if not specified. default: 20
cutSlideWindowSize	the window size option of cutSlideWindowRight, default to cutWindowSize if not specified. default: 4
cutSlideWindowQual	the mean quality requirement option for cutSlideWindowRight, default to cutMeanQual if not specified. default: 20
qualityFiltering	A logical indicating run quality filtering. Default is 'TRUE'.
qualityFilterPhred	the minimum quality value that a base is qualified. Default 15 means phred quality >=Q15 is qualified.
qualityFilterPercent	Maximum percents of bases are allowed to be unqualified (0~100). Default 40 means 40%
maxNfilter	maximum number of N allowed in the sequence. read/pair is discarded if failed to pass this filter. Default is 5
averageQualFilter	if one read's average quality score < 'averageQualFilter', then this read/pair is discarded. Default 0 means no requirement.
lengthFiltering	A logical indicating whether run lenght filtering. Default: TRUE
minReadLength	reads shorter than minReadLength will be discarded, default is 15.
maxReadLength	reads longer than maxReadLength will be discarded, default 0 means no limitation.
lowComplexityFiltering	A logical indicating whethere run low complexity filter. The complexity is defined as the percentage of base that is different from its next base (base[i] != base[i+1]). Default is 'FALSE'
minComplexity	the threshold for low complexity filter (0~100). Default is 30, which means 30% complexity is required. (int [=30])
index1Filter	specify a file contains a list of barcodes of index1 to be filtered out, one barcode per line.
index2Filter	specify a file contains a list of barcodes of index2 to be filtered out, one barcode per line.
maxIndexMismatch	the allowed difference of index barcode for index filtering, default 0 means completely identical.
correctionOverlap	A logical indicating run base correction in overlapped regions (only for PE data), default is 'FALSE'
minOverlapLength	the minimum length to detect overlapped region of PE reads. This will affect overlap analysis based PE merge, adapter trimming and correction. 30 by default.
maxOverlapMismatch	the maximum number of mismatched bases to detect overlapped region of PE reads. This will affect overlap analysis based PE merge, adapter trimming and correction. 5 by default.
maxOverlapMismatchPercentage	the maximum percentage of mismatched bases to detect overlapped region of PE reads. This will affect overlap analysis based PE merge, adapter trimming and correction. Default 20 means 20%
umi	A logical indicating whethere preprocessing unique molecular identifier (UMI). Default: 'FALSE'
umiLoc	specify the location of UMI, can be (index1/index2/read1/read2/per_index/per_read)
umiLength	length of UMI if the UMI is in read1/read2.
umiPrefix	an string indication the following string is UMI (i.e. prefix=UMI, UMI=AATTCG, final=UMIAATTCG). Only letters, numbers, and '#" allowed. No prefix by default.
umiSkipBaseLength	if the UMI is in read1/read2, skip 'umiSkipBaseLength' bases following UMI, default is 0.
umiNoConnection	an logical indicating remove "_" between the UMI prefix string and the UMI string. Default is FALSE.
umiIgnoreSeqNameSpace	an logical indicating ignore the space in the sequence name. Default is FALSE, the umi tag will be inserted into the sequence name before the first SPACE.
overrepresentationAnalysis	A logical indicating overrepresentation analysis. Default is 'FALSE'
overrepresentationSampling	one in 'overrepresentationSampling' reads will be computed for overrepresentation analysis (1~10000), smaller is slower, default is 20.
splitOutput	number of files to be splitted (2~999). a sequential number prefix will be added to output name. Default is 0 (no split)
splitByLines	split output by limiting lines of each file(>=1000), a sequential number prefix will be added to output name ( 0001.out.fq, 0002.out.fq...), default is 0 (disabled).
thread	owrker thread number, default is 2
verbose	output verbose log information

Value

returns a json object of the report.

Author(s)

Thomas Carroll, Wei Wang

Examples

# preprare for the input and output files.
# if the output file exists, it will be OVERWRITEN.

se_read1 <- system.file("extdata","Fox3_Std_small.fq.gz",package="Rfastp")
pe_read1 <- system.file("extdata","reads1.fastq.gz",package="Rfastp")
pe_read2 <- system.file("extdata","reads2.fastq.gz",package="Rfastp")
outputPrefix <- tempfile(tmpdir = tempdir())


# a normal single-end file

se_json_report <- rfastp(read1 = se_read1,
    outputFastq=paste0(outputPrefix, "_se"), thread = 4)


# merge paired-end data by overlap:

pe_json_report <- rfastp(read1 = pe_read1, read2 = pe_read2, merge = TRUE,
    outputFastq = paste0(outputPrefix, '_unpaired'),
    mergeOut = paste0(outputPrefix, '_merged.fastq.gz'))


# a clipr example

clipr_json_report <- rfastp(read1 = se_read1,
   outputFastq = paste0(outputPrefix, '_clipr'),
   disableTrimPolyG = TRUE,
   cutLowQualFront = TRUE,
   cutFrontWindowSize = 29,
   cutFrontMeanQual = 20,
   cutLowQualTail = TRUE,
   cutTailWindowSize = 1,
   cutTailMeanQual = 5,
   minReadLength = 29,
   adapterSequenceRead1 = 'GTGTCAGTCACTTCCAGCGG'
)

Rfastp documentation built on Nov. 8, 2020, 5:52 p.m.