ins: Insertions accessor

Description Usage Arguments Examples

Description

Gets the insertion vector of an object.

Usage

1
ins(x, ...)

Arguments

x

An object to get the insertion values of.

...

Additional arguments.

Examples

1
2
t <- triplex.search(DNAString("TATTTATTTTTTCATCTTCTTTTTTTATTTTT"), max_len=11)
ins(t);

triplex documentation built on Nov. 1, 2018, 4:21 a.m.