triplex.diagram: Triplex visualization, diagram representation

Description Usage Arguments Details Value Author(s) See Also Examples

View source: R/triplex.diagram.R

Description

This function visualizes a TriplexViews object as a 2D diagram. Nucleotides are drawn as characters in circles and bonds as lines between them (Watson-Crick or Hogsteen).

Usage

1
2
3
4
triplex.diagram(triplex, circles = TRUE, mbonds.lty = 1, 
                mbonds.lwd = 2.5, wcbonds.lty = 1, wcbonds.lwd = 1, 
                hbonds.lty = 2, hbonds.lwd = 1, labels.cex = 1, circles.cex = 1,
                margin = 0.1, bonds.length = 0.07)

Arguments

triplex

TriplexViews object including only one triplex.

circles

TRUE or FALSE: TRUE - nucleotides are drawn as characters in circles, FALSE - nucleotides are drawn just as characters.

mbonds.lty

Type of main (skelet) bonds lines.

mbonds.lwd

Width of main (skelet) bonds lines.

wcbonds.lty

Type of Watson-Crick bonds lines.

wcbonds.lwd

Width of Watson-Crick bonds lines.

hbonds.lty

Type of Hoogsteen bonds lines.

hbonds.lwd

Width of Hoogsteen bonds lines.

labels.cex

Multiplier of size of labels of nucleotides.

circles.cex

Multiplier of size of nucleotides.

margin

Left and right margin of the picture.

bonds.length

Length of lines representing Watson-Crick and Hoogsteen bonds.

Details

The input TriplexViews object is required to provide additional algorithm options (see triplex.search). These are used for proper computation of triplex alignment.

An example of a graphical output corresponding to a triplex of type 3 with DNA sequence "GGAAAGCAATGCCAGGCAGGG" is shown in the following figure

triplex2d.png

Value

Instance of DNAStringSet object with computed alignment.

Author(s)

Kamil Rajdl, Jiri Hon

See Also

triplex.3D, triplex.search, triplex.alignment

Examples

1
2
3
seq <- DNAString("GGAAAGCAATGCCAGGCAGGG")
t <- triplex.search(seq, min_score=10, p_value=1)
triplex.diagram(t[1])

triplex documentation built on Nov. 17, 2017, 1:37 p.m.