triplex.diagram: Triplex visualization, diagram representation

Description Usage Arguments Details Value Author(s) See Also Examples

View source: R/triplex.diagram.R


This function visualizes a TriplexViews object as a 2D diagram. Nucleotides are drawn as characters in circles and bonds as lines between them (Watson-Crick or Hogsteen).


triplex.diagram(triplex, circles = TRUE, mbonds.lty = 1, 
                mbonds.lwd = 2.5, wcbonds.lty = 1, wcbonds.lwd = 1, 
                hbonds.lty = 2, hbonds.lwd = 1, labels.cex = 1, circles.cex = 1,
                margin = 0.1, bonds.length = 0.07)



TriplexViews object including only one triplex.


TRUE or FALSE: TRUE - nucleotides are drawn as characters in circles, FALSE - nucleotides are drawn just as characters.


Type of main (skelet) bonds lines.


Width of main (skelet) bonds lines.


Type of Watson-Crick bonds lines.


Width of Watson-Crick bonds lines.


Type of Hoogsteen bonds lines.


Width of Hoogsteen bonds lines.


Multiplier of size of labels of nucleotides.


Multiplier of size of nucleotides.


Left and right margin of the picture.


Length of lines representing Watson-Crick and Hoogsteen bonds.


The input TriplexViews object is required to provide additional algorithm options (see These are used for proper computation of triplex alignment.

An example of a graphical output corresponding to a triplex of type 3 with DNA sequence "GGAAAGCAATGCCAGGCAGGG" is shown in the following figure



Instance of DNAStringSet object with computed alignment.


Kamil Rajdl, Jiri Hon

See Also

triplex.3D,, triplex.alignment


t <-, min_score=10, p_value=1)

triplex documentation built on May 2, 2018, 4:23 a.m.