triplex.alignment: Triplex alignment
In triplex: Search and visualize intramolecular triplex-forming sequences in DNA

Description Usage Arguments Details Value Author(s) See Also Examples

This function computes best triplex alignment.

1	triplex.alignment(triplex)

triplex

TriplexViews object including only one triplex.

Similarly to other DNA multiple sequence alignments the output of the triplex.alignment method is stored as DNAStringSet object. This object consists of four sequences: plus and minus sequences representing 5' to 3' and 3' to 5' DNA strand of detected triplex; one of the anti-plus, anti-minus, para-plus or para-minus sequence representing the third triplex strand aligned to plus or minus strand in antiparallel or parallel fashion; and finally loop sequence representing unpaired loop.

Please note that all eight triplex types shown in following figure can be represented using four types of alignments, because each alignment can correspond to triplex detected either on forward or reverse DNA strand.

Figure: Triplex types

The input TriplexViews object is required to provide additional algorithm options (see triplex.search). These are used for proper computation of triplex alignment.

Instance of DNAStringSet object.

Jiri Hon

triplex.diagram, triplex.3D, triplex.search

1
2
3

seq <- DNAString("GGAAAGCAATGCCAGGCAGGG")
t <- triplex.search(seq, min_score=10, p_value=1)
triplex.alignment(t[1])

Loading required package: S4Vectors
Loading required package: stats4
Loading required package: BiocGenerics
Loading required package: parallel

Attaching package: ‘BiocGenerics’

The following objects are masked from ‘package:parallel’:

    clusterApply, clusterApplyLB, clusterCall, clusterEvalQ,
    clusterExport, clusterMap, parApply, parCapply, parLapply,
    parLapplyLB, parRapply, parSapply, parSapplyLB

The following objects are masked from ‘package:stats’:

    IQR, mad, sd, var, xtabs

The following objects are masked from ‘package:base’:

    anyDuplicated, append, as.data.frame, basename, cbind, colnames,
    dirname, do.call, duplicated, eval, evalq, Filter, Find, get, grep,
    grepl, intersect, is.unsorted, lapply, Map, mapply, match, mget,
    order, paste, pmax, pmax.int, pmin, pmin.int, Position, rank,
    rbind, Reduce, rownames, sapply, setdiff, sort, table, tapply,
    union, unique, unsplit, which.max, which.min


Attaching package: ‘S4Vectors’

The following object is masked from ‘package:base’:

    expand.grid

Loading required package: IRanges
Loading required package: XVector
Loading required package: Biostrings

Attaching package: ‘Biostrings’

The following object is masked from ‘package:base’:

    strsplit

Searching for triplex type 0...
Searching for triplex type 1...
Searching for triplex type 2...
Searching for triplex type 3...
Searching for triplex type 4...
Searching for triplex type 5...
Searching for triplex type 6...
Searching for triplex type 7...
DNAStringSet object of length 4:
    width seq                                               names               
[1]     8 CCCTGCCT                                          minus
[2]     8 GGGACGGA                                          plus
[3]     8 CCTTTCGT                                          para-minus
[4]     5 GGCAT                                             loop