triplex.alignment: Triplex alignment

Description Usage Arguments Details Value Author(s) See Also Examples

View source: R/triplex.align.R

Description

This function computes best triplex alignment.

Usage

1

Arguments

triplex

TriplexViews object including only one triplex.

Details

Similarly to other DNA multiple sequence alignments the output of the triplex.alignment method is stored as DNAStringSet object. This object consists of four sequences: plus and minus sequences representing 5' to 3' and 3' to 5' DNA strand of detected triplex; one of the anti-plus, anti-minus, para-plus or para-minus sequence representing the third triplex strand aligned to plus or minus strand in antiparallel or parallel fashion; and finally loop sequence representing unpaired loop.

Please note that all eight triplex types shown in following figure can be represented using four types of alignments, because each alignment can correspond to triplex detected either on forward or reverse DNA strand.

Figure: Triplex types

The input TriplexViews object is required to provide additional algorithm options (see triplex.search). These are used for proper computation of triplex alignment.

Value

Instance of DNAStringSet object.

Author(s)

Jiri Hon

See Also

triplex.diagram, triplex.3D, triplex.search

Examples

1
2
3
seq <- DNAString("GGAAAGCAATGCCAGGCAGGG")
t <- triplex.search(seq, min_score=10, p_value=1)
triplex.alignment(t[1])

triplex documentation built on Nov. 17, 2017, 1:37 p.m.