triplex.3D: Triplex visualization, 3D representation

Description Usage Arguments Details Value Author(s) See Also Examples

View source: R/triplex.3D.R

Description

This function visualizes a TriplexViews object as a 3D model. Its structure can be drawn with automatic optimalizations. To use this function, please install suggested rgl package from CRAN.

Usage

1
2
3
triplex.3D(triplex, opt = TRUE, A.col = "red", T.col = "brown", 
           G.col = "green", C.col = "blue", bbone.col = "violet", 
           bgr.col = "white", bbone.n = 20)

Arguments

triplex

TriplexViews object including only one triplex.

opt

TRUE or FALSE: TRUE - structure of triplex will be optimalized, FALSE - structure will be drawn without optimalization.

A.col

Color of Adine base.

T.col

Color of Thymin base.

G.col

Color of Guanine base.

C.col

Color of Cytosine base.

bgr.col

Color of background.

bbone.col

Color of backbone.

bbone.n

Number of sides of backbone bonds.

Details

The input TriplexViews object is required to provide additional algorithm options (see triplex.search). These are used for proper computation of triplex alignment.

An example of a graphical output corresponding to a triplex type 3 with DNA sequence "GGAAAGCAATGCCAGGCAGGG" is shown in the following figure

triplex3d.png

Value

Instance of DNAStringSet object with computed alignment.

Author(s)

Kamil Rajdl, Jiri Hon

See Also

triplex.diagram, triplex.search, triplex.alignment

Examples

1
2
3
4
5
6
seq <- DNAString("GGAAAGCAATGCCAGGCAGGG")
t <- triplex.search(seq, min_score=10, p_value=1)
## Not run: 
triplex.3D(t[1])

## End(Not run)

triplex documentation built on Nov. 1, 2018, 4:21 a.m.