Description Usage Arguments Details Value Author(s) See Also Examples
This function visualizes a TriplexViews
object as a 3D model.
Its structure can be drawn with automatic optimalizations.
To use this function, please install suggested rgl package from CRAN.
1 2 3 | triplex.3D(triplex, opt = TRUE, A.col = "red", T.col = "brown",
G.col = "green", C.col = "blue", bbone.col = "violet",
bgr.col = "white", bbone.n = 20)
|
triplex |
|
opt |
TRUE or FALSE: TRUE - structure of triplex will be optimalized, FALSE - structure will be drawn without optimalization. |
A.col |
Color of Adine base. |
T.col |
Color of Thymin base. |
G.col |
Color of Guanine base. |
C.col |
Color of Cytosine base. |
bgr.col |
Color of background. |
bbone.col |
Color of backbone. |
bbone.n |
Number of sides of backbone bonds. |
The input TriplexViews
object is required to provide additional
algorithm options (see triplex.search
). These are used for
proper computation of triplex alignment.
An example of a graphical output corresponding to a triplex type 3 with DNA sequence "GGAAAGCAATGCCAGGCAGGG" is shown in the following figure
Instance of DNAStringSet
object with computed alignment.
Kamil Rajdl, Jiri Hon
triplex.diagram
,
triplex.search
,
triplex.alignment
1 2 3 4 5 6 | seq <- DNAString("GGAAAGCAATGCCAGGCAGGG")
t <- triplex.search(seq, min_score=10, p_value=1)
## Not run:
triplex.3D(t[1])
## End(Not run)
|
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.