Nothing
#' Plot the Guide Strand with different optional seeds
#'
#' @param guide.seq Guide a.k.a anti-sense sequence oriented 5' > 3'. Sequence must
#' be greater than 8 bp.
#'
#' @return A msaggplot of the guide sequence in addition to the available
#' seed sequences
#'
#' @export
#'
#' @examples
#' library(msa)
#'
#' # Ttr siRNA sequence
#' guide.seq = "UUAUAGAGCAAGAACACUGUUUU"
#'
#' # generate seed plot
#' plotted.seeds = plot_seeds(guide.seq)
plot_seeds <- function(guide.seq){
mer7A1 = get_seed(guide.seq, "mer7A1")
mer8 = get_seed(guide.seq, "mer8")
mer6 = get_seed(guide.seq, "mer6")
mer7m8 = get_seed(guide.seq, "mer7m8")
# Define the set of seed sequences
set.seq = list("Guide" = mer7A1$Guide,
"mer7A1" = mer7A1$Seed.Seq.RNA,
"mer8" = mer8$Seed.Seq.RNA,
"mer6" = mer6$Seed.Seq.RNA,
"mer7m8" = mer7m8$Seed.Seq.RNA)
# Set the names of the sequence set
names(set.seq) = c("Guide", "mer7A1", "mer8", "mer6", "mer7m8")
# Create a RNAStringSet
plot.seqs.set = Biostrings::RNAStringSet(set.seq, use.names = TRUE)
# Perform multiple sequence alignment
results.msa = msa::msa(plot.seqs.set)
# Get the rna string set from the resultsing search
rna.str = Biostrings::RNAStringSet(results.msa)
msa.plot = ggmsa::ggmsa(rna.str,
font = 'DroidSansMono',
color = "Chemistry_NT",
none_bg = FALSE,
seq_name = TRUE,
use_dot = FALSE,
ref = "Guide",
consensus_views = TRUE,
by_conservation= FALSE) +
ggplot2::theme(axis.text.y = ggplot2::element_text(face="bold",
color="black",
size=16),
axis.text.x = ggplot2::element_text(size=14)) +
ggplot2::scale_x_continuous(breaks=seq_len(nchar(guide.seq)))
return (msa.plot)
}
Any scripts or data that you put into this service are public.
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.