shave | R Documentation |
This function uses the Viterbi algorithm to semi-globally align a motif to a DNA or AA sequence, and removes all nucleotides to the left and/or right of the motif.
shave(x, motif, direction = "both", cores = 1, ...)
x |
an object of class |
motif |
a |
direction |
character string indicating the direction of the shave. Options are "forward" (shaves everything to the right of the motif), "backward" (shaves everything to the left of the motif) or "both" (retains the motif region only). |
cores |
integer giving the number of processors for multithreading.
Defaults to 1, and reverts to 1 if |
... |
further arguments to be passed to |
This functions finds the optimal semiglobal alignment (a.k.a. "glocal"
alignment or global alignment with free end gaps) between a
sequence "x"
and a shorter sequence "motif"
, returning
the motif region of x along with the nucleotides to the left or right
if direction
is set to "reverse"
or "forward"
,
respectively.
an object of class DNAbin
or AAbin
(depending on the input object).
Shaun Wilkinson
virtualPCR
.
data(whales)
motif = char2dna("AAGTGTAGCATCACTTATTGATCCAAATT")
shave(whales, motif = motif, direction = "both")
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.