Description Usage Arguments Value Author(s) Examples
virtualPCR
queries a list of DNA sequences with virtual primers
(either sequences or profile hidden Markov models) and returns only
the sequences that contain regions of sufficient similarity based on
log-odds alignment scoring.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 |
x |
a list of DNA sequences in |
up |
an object of class |
down |
an optional argument the same type as |
rcdown |
logical indicating whether the reverse primer should be
reverse-complemented prior to aligning with the input sequences. Set
to TRUE only if |
trimprimers |
logical indicating whether the primer-binding sites should be removed from the sequences in the returned list. |
minfsc |
numeric, giving the minimum specificity(log-odds score for the optimal alignment) between the forward primer and a sequence for that sequence to be retained. |
minrsc |
numeric, the minimum specificity (log-odds score for the optimal alignment) between the reverse primer (if provided) and a sequence for that sequence to be retained. |
minamplen, maxamplen |
integers giving the minimum and maximum acceptable amplicon lengths. Sequences are discarded if the number of base pairs between the primer-binding sites falls outside of these limits. |
maxNs |
numeric giving the maximum acceptable proportion of the ambiguous residue "N" within the output sequences. Defaults to 0.02. |
partialbind |
logical indicating whether partial primer matching is accepted. Defaults to TRUE. |
cores |
integer giving the number of processors for multithreading.
Defaults to 1, and reverts to 1 if x is not a list.
This argument may alternatively be a 'cluster' object,
in which case it is the user's responsibility to close the socket
connection at the conclusion of the operation,
for example by running |
quiet |
logical indicating whether progress should be printed to the console. |
a list of trimmed sequences, an object of class
DNAbin
.
Shaun Wilkinson
1 2 3 4 5 | ## trim whale sequences using a new set of inner primers
inner_for <- "CGGTTGGGGTGACCTCGGAGTA"
inner_rev <- "GCTGTTATCCCTAGGGTAA"
whales_short <- virtualPCR(whales, up = inner_for, down = inner_rev,
trimprimers = TRUE)
|
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.