rmEndAdapter: Remove end adapter

In carlopacioni/amplicR: An R package to process amplicon data

Remove end adapter

Description

This function is used to remove end adapters, starting from a fastq file.

Usage

rmEndAdapter(
  fn,
  nRead = 1e+08,
  EndAdapter = "P7_last10",
  adapter.mismatch = 0,
  verbose = FALSE
)

Arguments

fn	Fully qualified name (i.e. the complete path) of the fastq file
nRead	The number of bytes or characters to be read at one time. See FastqStreamer for details
EndAdapter	A character vector with the sequence of the end adapter, "P7" or "P7_last10" (See details)
adapter.mismatch	The maximum number of allowed mismatch (See details)
verbose	Whether print out information on hits (default: FALSE)

Details

As mentioned in the general description of this package, most functions are tailored to Illumina architecture. rmEndAdapter was developed to remove the P7 adapter at the end of single-reads. However, it can be actually used to remove any 'tail'. Reads are trimmed at the first position of the match with the passed EndAdapter pattern. The sequence of the EndAdapter is passed (as character vector) in a 5' to 3' direction and it is internally reversed and complemented. Other than the sequence, it is possible to pass the character vector "P7" or "P7_last10". With the first, the sequence of the P7 adapter is selected (CAAGCAGAAGACGGCATACGAGAT). With the latter a partial match is searched for (the last 10 bp: CATACGAGAT).

Matches are searched using vmatchPattern, with adapter.mismatch used for max.mismatch (min.mismatch is fixed to zero).

The search is conducted with fixed=TRUE, which means (from Biostring): "an IUPAC ambiguity code in the pattern can only match the same code in the subject, and vice versa".

Value

A fastq file with the reads where the end adapter was found (and removed) saved in the same location where the input data was located. The file is named with the suffix "_EndAdRm". A list with the total number of reads that were processed and retained is also returned.

carlopacioni/amplicR documentation built on Aug. 19, 2023, 7:59 p.m.