inst/tests/test-lumiR.idat.R
In drmjc/lumidat: Methods for importing Illumina gene expression iDAT files
context("lumiR.idat suite")
test_that("iDAT files only", {
library(lumi)
options(width=80)
path <- system.file("extdata", package="lumidat")
files <- c("5356583020_A_Grn.idat", "5356583020_B_Grn.idat")
manifestfile <- system.file("extdata", "HumanHT-12_V3_0_R1_99999999.txt", package="lumidat")
x <- lumiR.idat(files, path, manifestfile=manifestfile, probeID="ProbeID")
expect_that(x, is_a("LumiBatch"))
expect_equivalent(dim(exprs(x)), c(90,2))
res <- capture.output(x)[-c(7,12:19)]
expected.res <- c("Summary of data information:", "\t Data File Information:",
"\t\tIllumina Inc. GenomeStudio version 1.8.0", "\t\tNormalization = none",
"\t\tArray Content = HumanHT-12_V3_0_R1_99999999.bgx.xml", "\t\tError Model = none",
"\t\tLocal Settings = en-US", "\t\t", "", "Major Operation History:",
"2 convertNuID = FALSE, lib.mapping = NULL, dec = \".\", parseColumnName = parseColumnName, ",
"3 checkDupId = checkDupId, QC = QC, columnNameGrepPattern = columnNameGrepPattern, ",
"4 inputAnnotation = FALSE, annotationColumn = \"SYMBOL\", verbose = verbose)",
"5 lumiQ(x.lumi = x.lumi, detectionTh = detectionTh, verbose = verbose)",
" lumiVersion", "1 2.10.1", "2 2.10.1", "3 2.10.1",
"4 2.10.1", "5 2.10.1", "", "Object Information:",
"LumiBatch (storageMode: lockedEnvironment)", "assayData: 90 features, 2 samples ",
" element names: beadNum, detection, exprs, se.exprs ", "protocolData: none",
"phenoData", " sampleNames: 5356583020_A 5356583020_B", " varLabels: sampleID",
" varMetadata: labelDescription", "featureData", " featureNames: ILMN_1704173 ILMN_1734742 ... ILMN_1755897 (90 total)",
" fvarLabels: ProbeID TargetID", " fvarMetadata: labelDescription",
"experimentData: use 'experimentData(object)'", "Annotation: ",
"Control Data: Available", "QC information: Please run summary(x, 'QC') for details!"
)
expect_equivalent(res, expected.res)
################################################################################
res <- head(controlData(x))
expected.res <- structure(list(controlType = c("biotin", "biotin", "cy3_hyb",
"cy3_hyb", "cy3_hyb", "cy3_hyb"), ProbeID = c("ILMN_1343048",
"ILMN_1343049", "ILMN_2038769", "ILMN_1343052", "ILMN_2038771",
"ILMN_2038770"), `5356583020_A` = c(16902.39, 20562.41, 17585.26,
410.2783, 3419.561, 15378.33), `5356583020_B` = c(16668.27, 20507.38,
15846.65, 407.3946, 3164.278, 15831.14)), .Names = c("controlType",
"ProbeID", "5356583020_A", "5356583020_B"), row.names = c("1",
"2", "3", "4", "5", "6"), class = "data.frame")
expect_equivalent(res, expected.res)
################################################################################
})
test_that("iDAT zipfile", {
library(lumi)
options(width=80)
path <- system.file("extdata", package="lumidat")
files <- c("5356583020_A_Grn.idat", "5356583020_B_Grn.idat")
manifestfile <- system.file("extdata", "HumanHT-12_V3_0_R1_99999999.txt", package="lumidat")
zipfile <- tempfile(fileext=".zip")
zip(zipfile, file.path(path, files), flags = "-r9Xq")
x <- lumiR.idat(zipfile=zipfile, manifestfile=manifestfile, probeID="ProbeID", verbose=FALSE)
expect_that(x, is_a("LumiBatch"))
expect_equivalent(dim(exprs(x)), c(90,2))
res <- capture.output(x)[-c(7,12:19)]
expected.res <- c("Summary of data information:", "\t Data File Information:",
"\t\tIllumina Inc. GenomeStudio version 1.8.0", "\t\tNormalization = none",
"\t\tArray Content = HumanHT-12_V3_0_R1_99999999.bgx.xml", "\t\tError Model = none",
"\t\tLocal Settings = en-US", "\t\t", "", "Major Operation History:",
"2 convertNuID = FALSE, lib.mapping = NULL, dec = \".\", parseColumnName = parseColumnName, ",
"3 checkDupId = checkDupId, QC = QC, columnNameGrepPattern = columnNameGrepPattern, ",
"4 inputAnnotation = FALSE, annotationColumn = \"SYMBOL\", verbose = verbose)",
"5 lumiQ(x.lumi = x.lumi, detectionTh = detectionTh, verbose = verbose)",
" lumiVersion", "1 2.10.1", "2 2.10.1", "3 2.10.1",
"4 2.10.1", "5 2.10.1", "", "Object Information:",
"LumiBatch (storageMode: lockedEnvironment)", "assayData: 90 features, 2 samples ",
" element names: beadNum, detection, exprs, se.exprs ", "protocolData: none",
"phenoData", " sampleNames: 5356583020_A 5356583020_B", " varLabels: sampleID",
" varMetadata: labelDescription", "featureData", " featureNames: ILMN_1704173 ILMN_1734742 ... ILMN_1755897 (90 total)",
" fvarLabels: ProbeID TargetID", " fvarMetadata: labelDescription",
"experimentData: use 'experimentData(object)'", "Annotation: ",
"Control Data: Available", "QC information: Please run summary(x, 'QC') for details!")
expect_equivalent(res, expected.res)
################################################################################
res <- head(controlData(x))
expected.res <- structure(list(controlType = c("biotin", "biotin", "cy3_hyb",
"cy3_hyb", "cy3_hyb", "cy3_hyb"), ProbeID = c("ILMN_1343048",
"ILMN_1343049", "ILMN_2038769", "ILMN_1343052", "ILMN_2038771",
"ILMN_2038770"), `5356583020_A` = c(16902.39, 20562.41, 17585.26,
410.2783, 3419.561, 15378.33), `5356583020_B` = c(16668.27, 20507.38,
15846.65, 407.3946, 3164.278, 15831.14)), .Names = c("controlType",
"ProbeID", "5356583020_A", "5356583020_B"), row.names = c("1",
"2", "3", "4", "5", "6"), class = "data.frame")
expect_equivalent(res, expected.res)
################################################################################
})
test_that("idat files + CLM", {
library(lumi)
options(width=80)
path <- system.file("extdata", package="lumidat")
files <- c("5356583020_A_Grn.idat", "5356583020_B_Grn.idat")
manifestfile <- system.file("extdata", "HumanHT-12_V3_0_R1_99999999.txt", package="lumidat")
clmfile <- system.file("extdata", "5356583020.clm", package="lumidat")
x <- lumiR.idat(files, path, manifestfile=manifestfile, clmfile=clmfile, probeID="ProbeID")
expect_that(x, is_a("LumiBatch"))
expect_equivalent(dim(exprs(x)), c(90,2))
expect_equivalent(sampleNames(x), c("A", "B"))
res <- grep("sampleNames", capture.output(x), value=TRUE)
expected.res <- " sampleNames: A B"
expect_equivalent(res, expected.res)
################################################################################
res <- colnames(controlData(x))
expected.res <- c("controlType", "ProbeID", "A", "B")
expect_equivalent(res, expected.res)
})
################################################################################
################################################################################
# Detection pvalue slot
test_that("detection p-values are stable", {
library(lumi)
options(width=80)
path <- system.file("extdata", package="lumidat")
files <- c("5356583020_A_Grn.idat", "5356583020_B_Grn.idat")
manifestfile <- system.file("extdata", "HumanHT-12_V3_0_R1_99999999.txt", package="lumidat")
x <- lumiR.idat(files, path, manifestfile=manifestfile, probeID="ProbeID")
expect_that(x, is_a("LumiBatch"))
res <- detection(x)[1:15,]
expected.res <- structure(c(0.0133333, 0, 0, 0, 0, 0, 0.9866667, 0.4666666, 0.0133333,
0, 0, 0.48, 0, 0, 0.0133333, 0.1333333, 0, 0, 0, 0, 0, 0.7066667,
0.6533333, 0, 0, 0, 0.8266667, 0, 0, 0), .Dim = c(15L, 2L), .Dimnames = list(
c("ILMN_1704173", "ILMN_1734742", "ILMN_1670130", "ILMN_2309245",
"ILMN_1809344", "ILMN_1793729", "ILMN_2385662", "ILMN_2205695",
"ILMN_1779257", "ILMN_1711453", "ILMN_1762281", "ILMN_1668162",
"ILMN_1804174", "ILMN_1763663", "ILMN_1912287"), c("5356583020_A",
"5356583020_B")))
expect_equivalent(res, expected.res)
})
################################################################################
################################################################################
# probeID=c("ProbeID", "ArrayAddressID", "Sequence", "NuID"),
test_that("probeID=ProbeID", {
library(lumi)
options(width=80)
path <- system.file("extdata", package="lumidat")
files <- c("5356583020_A_Grn.idat", "5356583020_B_Grn.idat")
manifestfile <- system.file("extdata", "HumanHT-12_V3_0_R1_99999999.txt", package="lumidat")
x <- lumiR.idat(files, path, manifestfile=manifestfile, probeID="ProbeID")
expect_that(x, is_a("LumiBatch"))
expect_equivalent(dim(exprs(x)), c(90,2))
################################################################################
res <- featureNames(x)[1:10]
expected.res <- c("ILMN_1704173", "ILMN_1734742", "ILMN_1670130", "ILMN_2309245",
"ILMN_1809344", "ILMN_1793729", "ILMN_2385662", "ILMN_2205695",
"ILMN_1779257", "ILMN_1711453")
expect_equivalent(res, expected.res)
################################################################################
res <- controlData(x)$ProbeID[1:5]
expected.res <- c("ILMN_1343048", "ILMN_1343049", "ILMN_2038769", "ILMN_1343052", "ILMN_2038771")
expect_equivalent(res, expected.res)
})
test_that("probeID=ArrayAddressID", {
library(lumi)
options(width=80)
path <- system.file("extdata", package="lumidat")
files <- c("5356583020_A_Grn.idat", "5356583020_B_Grn.idat")
manifestfile <- system.file("extdata", "HumanHT-12_V3_0_R1_99999999.txt", package="lumidat")
x <- lumiR.idat(files, path, manifestfile=manifestfile, probeID="ArrayAddressID")
expect_that(x, is_a("LumiBatch"))
expect_equivalent(dim(exprs(x)), c(90,2))
################################################################################
res <- featureNames(x)[1:10]
expected.res <- c("4260551", "4760255", "6510553", "650553", "4250544", "870110",
"2100176", "1740731", "6420520", "6020544")
expect_equivalent(res, expected.res)
################################################################################
res <- controlData(x)$ProbeID[1:5]
expected.res <- c("5090180", "6510136", "1110170", "1450438", "2510500")
expect_equivalent(res, expected.res)
})
test_that("probeID=Sequence", {
library(lumi)
options(width=80)
path <- system.file("extdata", package="lumidat")
files <- c("5356583020_A_Grn.idat", "5356583020_B_Grn.idat")
manifestfile <- system.file("extdata", "HumanHT-12_V3_0_R1_99999999.txt", package="lumidat")
x <- lumiR.idat(files, path, manifestfile=manifestfile, probeID="Sequence")
expect_that(x, is_a("LumiBatch"))
expect_equivalent(dim(exprs(x)), c(90,2))
################################################################################
res <- featureNames(x)[1:10]
expected.res <- c("AGCTCACATGCAGTAGACTTGGGCAGGCAAAGGGGGCACCAAGGGCACAG", "CAGGCCTTCCCTGACCCAGCCAGGAACAAACAAGGGACCAAGTGCACACA",
"CCACACACTCACCACTCCCAGCTTCTCGTGTCCAGTGAAACCCCTGAACC", "AGGGGCGTTCTCCCAAAGATTAGGTCGTTTTCCAAAGAGCCGCGTCCCGG",
"TCACACAGCTAGGTCTTTTCAGAAGTGGTGGAAATTGGCAGCTGGGGTAC", "CTTGCCTAGAGAACACACATGGGCTTTGGAGCCCGACAGACCTGGGCTTG",
"GCTGAGAGAGAAAGAAGCAGCTCTTGAAGAAATGCGTAAGAAGATGCACC", "CCAGGCTGGTCTCAGAATTCTGGTGAGTGATCCTCCCACAGTGGACTTCC",
"CATGGATGCCAACCGGTCACCCAGGAGGATGGCAAAGAGAGTCGCATCTC", "GCCCACAAGGAGGACTTACAATGTGGAACTTAGTCTCTTTCCCTCACTCC")
expect_equivalent(res, expected.res)
################################################################################
res <- controlData(x)$ProbeID[1:5]
expected.res <- c(
"GAATAAAGAACAATCTGCTGATGATCCCTCCGTGGATCTGATTCGTGTAA", "CCATGTGATACGAGGGCGCGTAGTTTGCATTATCGTTTTTATCGTTTCAA",
"AATTAAAACGATGCACACAGGGTTTAGCGCGTACACGTATTGCATTATGC", "TCTGTCACTGTCAGGAAAGTGGTAAAACTGCAACTCAATTACTGCAATGC",
"GCCCCGTATTCAGTGTCGCTGATTTGTATTGTCTGAAGTTGTTTTTACGT")
expect_equivalent(res, expected.res)
})
test_that("probeID=NuID", {
library(lumi)
options(width=80)
path <- system.file("extdata", package="lumidat")
files <- c("5356583020_A_Grn.idat", "5356583020_B_Grn.idat")
manifestfile <- system.file("extdata", "HumanHT-12_V3_0_R1_99999999.txt", package="lumidat")
x <- lumiR.idat(files, path, manifestfile=manifestfile, probeID="NuID")
expect_that(x, is_a("LumiBatch"))
expect_equivalent(dim(exprs(x)), c(90,2))
################################################################################
res <- featureNames(x)[1:10]
expected.res <- c("lJ0Tksh_pKQKqRQqRI", "NSl9XhUlKBAQqFC5EQ", "iURHRR1Sfdu1LgFXgU",
"QKpvdUCPK2.1AiWbVo", "Q0RJyt.0guugPpJ6rE", "0flyIEROp.olYSF6n4",
"ZniIgIJJ34IDmwgjkU", "9Up63SD3ri411RLofU", "QTo5QWtFSijpAiLZN0",
"NlRCih8Q7oHy3f1dHU")
expect_equivalent(res, expected.res)
################################################################################
res <- controlData(x)$ProbeID[1:5]
expected.res <- c("0gwIEN5441dbo3j27A", "BU7jGKmbL_Tzb.zb9A", "9DwBjkRKvyZsRs_Tzk",
"o3tHtKAusAeQdDx5Dk", "ulWz0u2eP7Pt4L7.xs")
expect_equivalent(res, expected.res)
})
test_that("probeID=ERROR", {
library(lumi)
options(width=80)
path <- system.file("extdata", package="lumidat")
files <- c("5356583020_A_Grn.idat", "5356583020_B_Grn.idat")
manifestfile <- system.file("extdata", "HumanHT-12_V3_0_R1_99999999.txt", package="lumidat")
expect_error(x <- lumiR.idat(files, path, manifestfile=manifestfile, probeID="ERROR"))
})
################################################################################
################################################################################
# collapseMode=c("none", "max", "median", "mean"),
test_that("collapseMode=none aka backgroundCorrect=FALSE", {
library(lumi)
options(width=80)
path <- system.file("extdata", package="lumidat")
files <- c("5356583020_A_Grn.idat", "5356583020_B_Grn.idat")
manifestfile <- system.file("extdata", "HumanHT-12_V3_0_R1_99999999.txt", package="lumidat")
x <- lumiR.idat(files, path, manifestfile=manifestfile, probeID="ProbeID", collapseMode="none")
expect_that(x, is_a("LumiBatch"))
expect_equivalent(dim(exprs(x)), c(90,2))
# these probes are from genes with >1 probes
probes <- c("ILMN_1744897", "ILMN_1801608", "ILMN_1711283", "ILMN_2296644",
"ILMN_1652609", "ILMN_1807467", "ILMN_1761911", "ILMN_2121316",
"ILMN_1810533", "ILMN_1659166", "ILMN_1679194", "ILMN_1755897")
x <- x[probes, ]
# > data.frame(as(featureData(x), "data.frame"),exprs(x), check.names=FALSE)
# ProbeID TargetID 5356583020_A 5356583020_B
# ILMN_1744897 ILMN_1744897 KCNN3 52.41120 60.19562
# ILMN_1801608 ILMN_1801608 KCNN3 69.06544 73.10770
# ILMN_1711283 ILMN_1711283 PCDHGA9 67.22208 51.06295
# ILMN_2296644 ILMN_2296644 PCDHGA9 58.62053 65.66985
# ILMN_1652609 ILMN_1652609 RGNEF 112.96380 82.18444
# ILMN_1807467 ILMN_1807467 RGNEF 57.53606 73.94498
# ILMN_1761911 ILMN_1761911 SCYL1BP1 187.19250 227.17070
# ILMN_2121316 ILMN_2121316 SCYL1BP1 142.36550 138.79320
# ILMN_1810533 ILMN_1810533 SLC6A15 76.14130 66.54485
# ILMN_1659166 ILMN_1659166 SLC6A15 58.84699 55.11340
# ILMN_1679194 ILMN_1679194 UGT2B7 58.90470 66.43938
# ILMN_1755897 ILMN_1755897 UGT2B7 62.35626 67.29924
################################################################################
res <- exprs(x)[1:6,]
expected.res <- structure(c(52.4112, 69.06544, 67.22208, 58.62053, 112.9638,
57.53606, 60.19562, 73.1077, 51.06295, 65.66985, 82.18444, 73.94498
), .Dim = c(6L, 2L), .Dimnames = list(c("ILMN_1744897", "ILMN_1801608",
"ILMN_1711283", "ILMN_2296644", "ILMN_1652609", "ILMN_1807467"
), c("5356583020_A", "5356583020_B")))
expect_equivalent(res, expected.res)
################################################################################
res <- controlData(x)[1:6,]
expected.res <- structure(list(controlType = c("biotin", "biotin", "cy3_hyb",
"cy3_hyb", "cy3_hyb", "cy3_hyb"), ProbeID = c("ILMN_1343048",
"ILMN_1343049", "ILMN_2038769", "ILMN_1343052", "ILMN_2038771",
"ILMN_2038770"), `5356583020_A` = c(16902.39, 20562.41, 17585.26,
410.2783, 3419.561, 15378.33), `5356583020_B` = c(16668.27, 20507.38,
15846.65, 407.3946, 3164.278, 15831.14)), .Names = c("controlType",
"ProbeID", "5356583020_A", "5356583020_B"), row.names = c("1",
"2", "3", "4", "5", "6"), class = "data.frame")
expect_equivalent(res, expected.res)
})
test_that("collapseMode=max", {
library(lumi)
options(width=80)
path <- system.file("extdata", package="lumidat")
files <- c("5356583020_A_Grn.idat", "5356583020_B_Grn.idat")
manifestfile <- system.file("extdata", "HumanHT-12_V3_0_R1_99999999.txt", package="lumidat")
expect_message(
x <- lumiR.idat(files, path, manifestfile=manifestfile, probeID="ProbeID", collapseMode="max"),
"addControlData2lumi can't handle data that's been collapsed. forcing controls=FALSE"
)
expect_that(x, is_a("LumiBatch"))
expect_equivalent(dim(exprs(x)), c(82,2))
# subset to the genes which have >1 probes
x <- x[c("KCNN3", "NOMO1", "PCDHGA9", "RGNEF", "SCYL1BP1", "SLC6A15", "UGT2B7"), ]
# here's the data from collapseMode=none; i'll choose the right probe & double check below
# > data.frame(as(featureData(x), "data.frame"),exprs(x), check.names=FALSE)
# ProbeID TargetID 5356583020_A
# ILMN_1744897 ILMN_1744897 KCNN3 52.41120
# ILMN_1801608 ILMN_1801608 KCNN3 69.06544 <<<<
# ILMN_1711283 ILMN_1711283 PCDHGA9 67.22208 <<<<
# ILMN_2296644 ILMN_2296644 PCDHGA9 58.62053
# ILMN_1652609 ILMN_1652609 RGNEF 112.96380 <<<<
# ILMN_1807467 ILMN_1807467 RGNEF 57.53606
# ILMN_1761911 ILMN_1761911 SCYL1BP1 187.19250 <<<<
# ILMN_2121316 ILMN_2121316 SCYL1BP1 142.36550
# ILMN_1810533 ILMN_1810533 SLC6A15 76.14130 <<<<
# ILMN_1659166 ILMN_1659166 SLC6A15 58.84699
# ILMN_1679194 ILMN_1679194 UGT2B7 58.90470
# ILMN_1755897 ILMN_1755897 UGT2B7 62.35626 <<<<
################################################################################
res <- exprs(x)
expected.res <- structure(c(69.06544, 402.4396, 67.22208, 112.9638, 187.1925,
76.1413, 62.35626, 73.1077, 251.4016, 65.66985, 82.18444, 227.1707,
66.54485, 67.29924), .Dim = c(7L, 2L), .Dimnames = list(c("KCNN3",
"NOMO1", "PCDHGA9", "RGNEF", "SCYL1BP1", "SLC6A15", "UGT2B7"),
c("5356583020_A", "5356583020_B")))
# 5356583020_A 5356583020_B
# KCNN3 69.06544 73.10770
# NOMO1 402.43960 251.40160
# PCDHGA9 67.22208 65.66985
# RGNEF 112.96380 82.18444
# SCYL1BP1 187.19250 227.17070
# SLC6A15 76.14130 66.54485
# UGT2B7 62.35626 67.29924
expect_equivalent(res, expected.res)
# ^^^^ agrees with my manual assessment
################################################################################
res <- detection(x)
expected.res <- structure(c(0.0933333, 0, 0.1066667, 0, 0, 0.0266666, 0.1866667,
0.0266666, 0, 0.0933333, 0, 0, 0.0933333, 0.0933333), .Dim = c(7L,
2L), .Dimnames = list(c("KCNN3", "NOMO1", "PCDHGA9", "RGNEF",
"SCYL1BP1", "SLC6A15", "UGT2B7"), c("5356583020_A", "5356583020_B"
)))
# 5356583020_A 5356583020_B
# KCNN3 0.0933333 0.0266666
# NOMO1 0.0000000 0.0000000
# PCDHGA9 0.1066667 0.0933333
# RGNEF 0.0000000 0.0000000
# SCYL1BP1 0.0000000 0.0000000
# SLC6A15 0.0266666 0.0933333
# UGT2B7 0.1866667 0.0933333
expect_equivalent(res, expected.res)
})
test_that("collapseMode=median", {
library(lumi)
options(width=80)
path <- system.file("extdata", package="lumidat")
files <- c("5356583020_A_Grn.idat", "5356583020_B_Grn.idat")
manifestfile <- system.file("extdata", "HumanHT-12_V3_0_R1_99999999.txt", package="lumidat")
expect_message(
x <- lumiR.idat(files, path, manifestfile=manifestfile, probeID="ProbeID", collapseMode="median"),
"addControlData2lumi can't handle data that's been collapsed. forcing controls=FALSE"
)
expect_that(x, is_a("LumiBatch"))
expect_equivalent(dim(exprs(x)), c(82,2))
# subset to the genes which have >1 probes
x <- x[c("KCNN3", "NOMO1", "PCDHGA9", "RGNEF", "SCYL1BP1", "SLC6A15", "UGT2B7"), ]
# here's the data from collapseMode=none; i'll choose the right probe & double check below
# > data.frame(as(featureData(x), "data.frame"),exprs(x), check.names=FALSE)
# ProbeID TargetID 5356583020_A
# ILMN_1744897 ILMN_1744897 KCNN3 52.41120
# ILMN_1801608 ILMN_1801608 KCNN3 69.06544
# ILMN_1711283 ILMN_1711283 PCDHGA9 67.22208
# ILMN_2296644 ILMN_2296644 PCDHGA9 58.62053
# ILMN_1652609 ILMN_1652609 RGNEF 112.96380
# ILMN_1807467 ILMN_1807467 RGNEF 57.53606
# ILMN_1761911 ILMN_1761911 SCYL1BP1 187.19250
# ILMN_2121316 ILMN_2121316 SCYL1BP1 142.36550
# ILMN_1810533 ILMN_1810533 SLC6A15 76.14130
# ILMN_1659166 ILMN_1659166 SLC6A15 58.84699
# ILMN_1679194 ILMN_1679194 UGT2B7 58.90470
# ILMN_1755897 ILMN_1755897 UGT2B7 62.35626
################################################################################
res <- exprs(x)
expected.res <- structure(c(60.73832, 381.8736, 62.9213, 85.24995, 164.779, 67.49415,
60.63048, 66.65166, 224.6189, 58.3664, 78.06471, 182.982, 60.82912,
66.86931), .Dim = c(7L, 2L), .Dimnames = list(c("KCNN3", "NOMO1",
"PCDHGA9", "RGNEF", "SCYL1BP1", "SLC6A15", "UGT2B7"), c("5356583020_A",
"5356583020_B")))
# 5356583020_A 5356583020_B
# KCNN3 60.73832 66.65166
# NOMO1 381.87360 224.61890
# PCDHGA9 62.92130 58.36640
# RGNEF 85.24995 78.06471
# SCYL1BP1 164.77900 182.98200
# SLC6A15 67.49415 60.82912
# UGT2B7 60.63048 66.86931
expect_equivalent(res, expected.res)
## ah ok, collapseMode=median reverts to the 'arithmetic mean' of the middle 2 elements.
################################################################################
## same as for collapseMode=max... is that right??
res <- detection(x)
expected.res <- structure(c(0.0933333, 0, 0.1066667, 0, 0, 0.0266666, 0.1866667,
0.0266666, 0, 0.0933333, 0, 0, 0.0933333, 0.0933333), .Dim = c(7L,
2L), .Dimnames = list(c("KCNN3", "NOMO1", "PCDHGA9", "RGNEF",
"SCYL1BP1", "SLC6A15", "UGT2B7"), c("5356583020_A", "5356583020_B"
)))
# 5356583020_A 5356583020_B
# KCNN3 0.0933333 0.0266666
# NOMO1 0.0000000 0.0000000
# PCDHGA9 0.1066667 0.0933333
# RGNEF 0.0000000 0.0000000
# SCYL1BP1 0.0000000 0.0000000
# SLC6A15 0.0266666 0.0933333
# UGT2B7 0.1866667 0.0933333
expect_equivalent(res, expected.res)
})
test_that("collapseMode=mean", {
library(lumi)
options(width=80)
path <- system.file("extdata", package="lumidat")
files <- c("5356583020_A_Grn.idat", "5356583020_B_Grn.idat")
manifestfile <- system.file("extdata", "HumanHT-12_V3_0_R1_99999999.txt", package="lumidat")
expect_message(
x <- lumiR.idat(files, path, manifestfile=manifestfile, probeID="ProbeID", collapseMode="mean"),
"addControlData2lumi can't handle data that's been collapsed. forcing controls=FALSE"
)
expect_that(x, is_a("LumiBatch"))
expect_equivalent(dim(exprs(x)), c(82,2))
# subset to the genes which have >1 probes
x <- x[c("KCNN3", "NOMO1", "PCDHGA9", "RGNEF", "SCYL1BP1", "SLC6A15", "UGT2B7"), ]
################################################################################
res <- exprs(x)
expected.res <- structure(c(60.73832, 286.5653, 62.9213, 85.24995, 164.779, 67.49415,
60.63048, 66.65166, 182.4367, 58.3664, 78.06471, 182.982, 60.82912,
66.86931), .Dim = c(7L, 2L), .Dimnames = list(c("KCNN3", "NOMO1",
"PCDHGA9", "RGNEF", "SCYL1BP1", "SLC6A15", "UGT2B7"), c("5356583020_A",
"5356583020_B")))
# 5356583020_A 5356583020_B
# KCNN3 60.73832 66.65166
# NOMO1 286.56530 182.43670
# PCDHGA9 62.92130 58.36640
# RGNEF 85.24995 78.06471
# SCYL1BP1 164.77900 182.98200
# SLC6A15 67.49415 60.82912
# UGT2B7 60.63048 66.86931
expect_equivalent(res, expected.res)
################################################################################
## same as for collapseMode=max... is that right??
res <- detection(x)
expected.res <- structure(c(0.4333333, 0.00888889999999998, 0.2666667, 0.2333333,
0, 0.2133333, 0.2933333, 0.12, 0.00888889999999998, 0.42, 0.0133333,
0, 0.3, 0.0933333), .Dim = c(7L, 2L), .Dimnames = list(c("KCNN3",
"NOMO1", "PCDHGA9", "RGNEF", "SCYL1BP1", "SLC6A15", "UGT2B7"),
c("5356583020_A", "5356583020_B")))
# 5356583020_A 5356583020_B
# KCNN3 0.4333333 0.1200000
# NOMO1 0.0088889 0.0088889
# PCDHGA9 0.2666667 0.4200000
# RGNEF 0.2333333 0.0133333
# SCYL1BP1 0.0000000 0.0000000
# SLC6A15 0.2133333 0.3000000
# UGT2B7 0.2933333 0.0933333
expect_equivalent(res, expected.res)
# this **is** different to collapseMode=mean, great.
})
################################################################################
################################################################################
test_that("backgroundCorrect=TRUE", {
library(lumi)
options(width=80)
path <- system.file("extdata", package="lumidat")
files <- c("5356583020_A_Grn.idat", "5356583020_B_Grn.idat")
manifestfile <- system.file("extdata", "HumanHT-12_V3_0_R1_99999999.txt", package="lumidat")
x <- lumiR.idat(files, path, manifestfile=manifestfile, probeID="ProbeID", backgroundCorrect=TRUE)
expect_that(x, is_a("LumiBatch"))
expect_equivalent(dim(exprs(x)), c(90,2))
################################################################################
res <- exprs(x)[1:6,]
expected.res <- structure(c(30.52452, 1113.839, 1028.59, 724.6708, 394.9726,
1315.341, 6.253441, 802.3579, 902.5901, 507.5767, 466.2357, 1211.94
), .Dim = c(6L, 2L), .Dimnames = list(c("ILMN_1704173", "ILMN_1734742",
"ILMN_1670130", "ILMN_2309245", "ILMN_1809344", "ILMN_1793729"
), c("5356583020_A", "5356583020_B")))
expect_equivalent(res, expected.res)
################################################################################
res <- controlData(x)[1:6,]
expected.res <- structure(list(controlType = c("biotin", "biotin", "cy3_hyb",
"cy3_hyb", "cy3_hyb", "cy3_hyb"), ProbeID = c("ILMN_1343048",
"ILMN_1343049", "ILMN_2038769", "ILMN_1343052", "ILMN_2038771",
"ILMN_2038770"), `5356583020_A` = c(16902.39, 20562.41, 17585.26,
410.2783, 3419.561, 15378.33), `5356583020_B` = c(16668.27, 20507.38,
15846.65, 407.3946, 3164.278, 15831.14)), .Names = c("controlType",
"ProbeID", "5356583020_A", "5356583020_B"), row.names = c("1",
"2", "3", "4", "5", "6"), class = "data.frame")
expect_equivalent(res, expected.res)
})
################################################################################
################################################################################
# forbidden params: c("convertNuID", "lib.mapping", "dec", "inputAnnotation", "annotationColumn"),
test_that("forbidden parameters throw errors", {
library(lumi)
options(width=80)
path <- system.file("extdata", package="lumidat")
files <- c("5356583020_A_Grn.idat", "5356583020_B_Grn.idat")
manifestfile <- system.file("extdata", "HumanHT-12_V3_0_R1_99999999.txt", package="lumidat")
################################################################################
expect_error(x <- lumiR.idat(files, path, manifestfile=manifestfile, convertNuID=TRUE))
expect_error(x <- lumiR.idat(files, path, manifestfile=manifestfile, lib.mapping="garbage"))
expect_error(x <- lumiR.idat(files, path, manifestfile=manifestfile, dec="."))
expect_error(x <- lumiR.idat(files, path, manifestfile=manifestfile, inputAnnotation="garbage"))
expect_error(x <- lumiR.idat(files, path, manifestfile=manifestfile, annotationColumn="garbage"))
})
################################################################################
################################################################################
# # lumi::lumiR arguments:
# detectionTh=0.01, na.rm=TRUE, parseColumnName=FALSE, checkDupId=TRUE, QC=TRUE,
# columnNameGrepPattern=list(exprs='AVG_SIGNAL', se.exprs='BEAD_STD', detection='DETECTION', beadNum='Avg_NBEADS'),
## this seem to match the A or B from within the array barcodes, eg 5356583020_A_AVG_SIGNAL
test_that("parseColumnName=TRUE", {
library(lumi)
options(width=80)
path <- system.file("extdata", package="lumidat")
files <- c("5356583020_A_Grn.idat", "5356583020_B_Grn.idat")
manifestfile <- system.file("extdata", "HumanHT-12_V3_0_R1_99999999.txt", package="lumidat")
x <- lumiR.idat(files, path, manifestfile=manifestfile, parseColumnName=TRUE)
res <- sampleNames(x)
expected.res <- c("A", "B")
expect_equivalent(res, expected.res)
})
# does nothing with these input files
test_that("checkDupId=TRUE", {
library(lumi)
options(width=80)
path <- system.file("extdata", package="lumidat")
files <- c("5356583020_A_Grn.idat", "5356583020_B_Grn.idat")
manifestfile <- system.file("extdata", "HumanHT-12_V3_0_R1_99999999.txt", package="lumidat")
x <- lumiR.idat(files, path, manifestfile=manifestfile, checkDupId=TRUE)
expect_that(x, is_a("LumiBatch"))
})
# boring too...
test_that("QC=FALSE", {
library(lumi)
options(width=80)
path <- system.file("extdata", package="lumidat")
files <- c("5356583020_A_Grn.idat", "5356583020_B_Grn.idat")
manifestfile <- system.file("extdata", "HumanHT-12_V3_0_R1_99999999.txt", package="lumidat")
x <- lumiR.idat(files, path, manifestfile=manifestfile, QC=FALSE)
expect_that(x, is_a("LumiBatch"))
})
# columnNameGrepPattern=list(exprs='AVG_SIGNAL', se.exprs='BEAD_STD', detection='DETECTION', beadNum='Avg_NBEADS')
test_that("columnNameGrepPattern=MIN_SIGNAL", {
library(lumi)
options(width=80)
path <- system.file("extdata", package="lumidat")
files <- c("5356583020_A_Grn.idat", "5356583020_B_Grn.idat")
manifestfile <- system.file("extdata", "HumanHT-12_V3_0_R1_99999999.txt", package="lumidat")
x <- lumiR.idat(files, path, manifestfile=manifestfile, columnNameGrepPattern=list(exprs='MIN_SIGNAL', se.exprs='BEAD_STD', detection='DETECTION', beadNum='Avg_NBEADS'))
expect_that(x, is_a("LumiBatch"))
res <- exprs(x)[1:6,]
expected.res <- structure(c(88.54737, 1171.861, 1086.613, 782.6937, 452.9955,
1373.364, 62.09662, 858.2011, 958.4333, 563.4199, 522.0789, 1267.783
), .Dim = c(6L, 2L), .Dimnames = list(c("ILMN_1704173", "ILMN_1734742",
"ILMN_1670130", "ILMN_2309245", "ILMN_1809344", "ILMN_1793729"
), c("5356583020_A", "5356583020_B")))
expect_equivalent(res, expected.res)
# @TODO deliberate error to make MJC consider:
# why are MIN_SIGNAL,MAX_Signal,AVG_SIGNAL all identical? is it just this test data??
expect_equivalent(TRUE, FALSE)
})
test_that("columnNameGrepPattern=MAX_Signal", {
library(lumi)
options(width=80)
path <- system.file("extdata", package="lumidat")
files <- c("5356583020_A_Grn.idat", "5356583020_B_Grn.idat")
manifestfile <- system.file("extdata", "HumanHT-12_V3_0_R1_99999999.txt", package="lumidat")
x <- lumiR.idat(files, path, manifestfile=manifestfile, columnNameGrepPattern=list(exprs='MAX_Signal', se.exprs='BEAD_STD', detection='DETECTION', beadNum='Avg_NBEADS'))
expect_that(x, is_a("LumiBatch"))
res <- exprs(x)[1:6,]
expected.res <- structure(c(88.54737, 1171.861, 1086.613, 782.6937, 452.9955,
1373.364, 62.09662, 858.2011, 958.4333, 563.4199, 522.0789, 1267.783
), .Dim = c(6L, 2L), .Dimnames = list(c("ILMN_1704173", "ILMN_1734742",
"ILMN_1670130", "ILMN_2309245", "ILMN_1809344", "ILMN_1793729"
), c("5356583020_A", "5356583020_B")))
expect_equivalent(res, expected.res)
# @TODO deliberate error to make MJC consider:
# why are MIN_SIGNAL,MAX_Signal,AVG_SIGNAL all identical? is it just this test data??
expect_equivalent(TRUE, FALSE)
})
# # dropping the final terms in columnNameGrepPattern don't have an effet, at least on detection(), se.exprs(),
# # so default values must be enforced
# test_that("columnNameGrepPattern simple, exprs only", {
# library(lumi)
# options(width=80)
#
# path <- system.file("extdata", package="lumidat")
# files <- c("5356583020_A_Grn.idat", "5356583020_B_Grn.idat")
# manifestfile <- system.file("extdata", "HumanHT-12_V3_0_R1_99999999.txt", package="lumidat")
#
# x <- lumiR.idat(files, path, manifestfile=manifestfile, columnNameGrepPattern=list(exprs='AVG_Signal'))
# expect_that(x, is_a("LumiBatch"))
# })
drmjc/lumidat documentation built on May 15, 2019, 2:23 p.m.
R Package Documentation
Browse R Packages
We want your feedback!
Note that we can't provide technical support on individual packages. You should contact the package authors for that.
context("lumiR.idat suite")
test_that("iDAT files only", {
library(lumi)
options(width=80)
path <- system.file("extdata", package="lumidat")
files <- c("5356583020_A_Grn.idat", "5356583020_B_Grn.idat")
manifestfile <- system.file("extdata", "HumanHT-12_V3_0_R1_99999999.txt", package="lumidat")
x <- lumiR.idat(files, path, manifestfile=manifestfile, probeID="ProbeID")
expect_that(x, is_a("LumiBatch"))
expect_equivalent(dim(exprs(x)), c(90,2))
res <- capture.output(x)[-c(7,12:19)]
expected.res <- c("Summary of data information:", "\t Data File Information:",
"\t\tIllumina Inc. GenomeStudio version 1.8.0", "\t\tNormalization = none",
"\t\tArray Content = HumanHT-12_V3_0_R1_99999999.bgx.xml", "\t\tError Model = none",
"\t\tLocal Settings = en-US", "\t\t", "", "Major Operation History:",
"2 convertNuID = FALSE, lib.mapping = NULL, dec = \".\", parseColumnName = parseColumnName, ",
"3 checkDupId = checkDupId, QC = QC, columnNameGrepPattern = columnNameGrepPattern, ",
"4 inputAnnotation = FALSE, annotationColumn = \"SYMBOL\", verbose = verbose)",
"5 lumiQ(x.lumi = x.lumi, detectionTh = detectionTh, verbose = verbose)",
" lumiVersion", "1 2.10.1", "2 2.10.1", "3 2.10.1",
"4 2.10.1", "5 2.10.1", "", "Object Information:",
"LumiBatch (storageMode: lockedEnvironment)", "assayData: 90 features, 2 samples ",
" element names: beadNum, detection, exprs, se.exprs ", "protocolData: none",
"phenoData", " sampleNames: 5356583020_A 5356583020_B", " varLabels: sampleID",
" varMetadata: labelDescription", "featureData", " featureNames: ILMN_1704173 ILMN_1734742 ... ILMN_1755897 (90 total)",
" fvarLabels: ProbeID TargetID", " fvarMetadata: labelDescription",
"experimentData: use 'experimentData(object)'", "Annotation: ",
"Control Data: Available", "QC information: Please run summary(x, 'QC') for details!"
)
expect_equivalent(res, expected.res)
################################################################################
res <- head(controlData(x))
expected.res <- structure(list(controlType = c("biotin", "biotin", "cy3_hyb",
"cy3_hyb", "cy3_hyb", "cy3_hyb"), ProbeID = c("ILMN_1343048",
"ILMN_1343049", "ILMN_2038769", "ILMN_1343052", "ILMN_2038771",
"ILMN_2038770"), `5356583020_A` = c(16902.39, 20562.41, 17585.26,
410.2783, 3419.561, 15378.33), `5356583020_B` = c(16668.27, 20507.38,
15846.65, 407.3946, 3164.278, 15831.14)), .Names = c("controlType",
"ProbeID", "5356583020_A", "5356583020_B"), row.names = c("1",
"2", "3", "4", "5", "6"), class = "data.frame")
expect_equivalent(res, expected.res)
################################################################################
})
test_that("iDAT zipfile", {
library(lumi)
options(width=80)
path <- system.file("extdata", package="lumidat")
files <- c("5356583020_A_Grn.idat", "5356583020_B_Grn.idat")
manifestfile <- system.file("extdata", "HumanHT-12_V3_0_R1_99999999.txt", package="lumidat")
zipfile <- tempfile(fileext=".zip")
zip(zipfile, file.path(path, files), flags = "-r9Xq")
x <- lumiR.idat(zipfile=zipfile, manifestfile=manifestfile, probeID="ProbeID", verbose=FALSE)
expect_that(x, is_a("LumiBatch"))
expect_equivalent(dim(exprs(x)), c(90,2))
res <- capture.output(x)[-c(7,12:19)]
expected.res <- c("Summary of data information:", "\t Data File Information:",
"\t\tIllumina Inc. GenomeStudio version 1.8.0", "\t\tNormalization = none",
"\t\tArray Content = HumanHT-12_V3_0_R1_99999999.bgx.xml", "\t\tError Model = none",
"\t\tLocal Settings = en-US", "\t\t", "", "Major Operation History:",
"2 convertNuID = FALSE, lib.mapping = NULL, dec = \".\", parseColumnName = parseColumnName, ",
"3 checkDupId = checkDupId, QC = QC, columnNameGrepPattern = columnNameGrepPattern, ",
"4 inputAnnotation = FALSE, annotationColumn = \"SYMBOL\", verbose = verbose)",
"5 lumiQ(x.lumi = x.lumi, detectionTh = detectionTh, verbose = verbose)",
" lumiVersion", "1 2.10.1", "2 2.10.1", "3 2.10.1",
"4 2.10.1", "5 2.10.1", "", "Object Information:",
"LumiBatch (storageMode: lockedEnvironment)", "assayData: 90 features, 2 samples ",
" element names: beadNum, detection, exprs, se.exprs ", "protocolData: none",
"phenoData", " sampleNames: 5356583020_A 5356583020_B", " varLabels: sampleID",
" varMetadata: labelDescription", "featureData", " featureNames: ILMN_1704173 ILMN_1734742 ... ILMN_1755897 (90 total)",
" fvarLabels: ProbeID TargetID", " fvarMetadata: labelDescription",
"experimentData: use 'experimentData(object)'", "Annotation: ",
"Control Data: Available", "QC information: Please run summary(x, 'QC') for details!")
expect_equivalent(res, expected.res)
################################################################################
res <- head(controlData(x))
expected.res <- structure(list(controlType = c("biotin", "biotin", "cy3_hyb",
"cy3_hyb", "cy3_hyb", "cy3_hyb"), ProbeID = c("ILMN_1343048",
"ILMN_1343049", "ILMN_2038769", "ILMN_1343052", "ILMN_2038771",
"ILMN_2038770"), `5356583020_A` = c(16902.39, 20562.41, 17585.26,
410.2783, 3419.561, 15378.33), `5356583020_B` = c(16668.27, 20507.38,
15846.65, 407.3946, 3164.278, 15831.14)), .Names = c("controlType",
"ProbeID", "5356583020_A", "5356583020_B"), row.names = c("1",
"2", "3", "4", "5", "6"), class = "data.frame")
expect_equivalent(res, expected.res)
################################################################################
})
test_that("idat files + CLM", {
library(lumi)
options(width=80)
path <- system.file("extdata", package="lumidat")
files <- c("5356583020_A_Grn.idat", "5356583020_B_Grn.idat")
manifestfile <- system.file("extdata", "HumanHT-12_V3_0_R1_99999999.txt", package="lumidat")
clmfile <- system.file("extdata", "5356583020.clm", package="lumidat")
x <- lumiR.idat(files, path, manifestfile=manifestfile, clmfile=clmfile, probeID="ProbeID")
expect_that(x, is_a("LumiBatch"))
expect_equivalent(dim(exprs(x)), c(90,2))
expect_equivalent(sampleNames(x), c("A", "B"))
res <- grep("sampleNames", capture.output(x), value=TRUE)
expected.res <- " sampleNames: A B"
expect_equivalent(res, expected.res)
################################################################################
res <- colnames(controlData(x))
expected.res <- c("controlType", "ProbeID", "A", "B")
expect_equivalent(res, expected.res)
})
################################################################################
################################################################################
# Detection pvalue slot
test_that("detection p-values are stable", {
library(lumi)
options(width=80)
path <- system.file("extdata", package="lumidat")
files <- c("5356583020_A_Grn.idat", "5356583020_B_Grn.idat")
manifestfile <- system.file("extdata", "HumanHT-12_V3_0_R1_99999999.txt", package="lumidat")
x <- lumiR.idat(files, path, manifestfile=manifestfile, probeID="ProbeID")
expect_that(x, is_a("LumiBatch"))
res <- detection(x)[1:15,]
expected.res <- structure(c(0.0133333, 0, 0, 0, 0, 0, 0.9866667, 0.4666666, 0.0133333,
0, 0, 0.48, 0, 0, 0.0133333, 0.1333333, 0, 0, 0, 0, 0, 0.7066667,
0.6533333, 0, 0, 0, 0.8266667, 0, 0, 0), .Dim = c(15L, 2L), .Dimnames = list(
c("ILMN_1704173", "ILMN_1734742", "ILMN_1670130", "ILMN_2309245",
"ILMN_1809344", "ILMN_1793729", "ILMN_2385662", "ILMN_2205695",
"ILMN_1779257", "ILMN_1711453", "ILMN_1762281", "ILMN_1668162",
"ILMN_1804174", "ILMN_1763663", "ILMN_1912287"), c("5356583020_A",
"5356583020_B")))
expect_equivalent(res, expected.res)
})
################################################################################
################################################################################
# probeID=c("ProbeID", "ArrayAddressID", "Sequence", "NuID"),
test_that("probeID=ProbeID", {
library(lumi)
options(width=80)
path <- system.file("extdata", package="lumidat")
files <- c("5356583020_A_Grn.idat", "5356583020_B_Grn.idat")
manifestfile <- system.file("extdata", "HumanHT-12_V3_0_R1_99999999.txt", package="lumidat")
x <- lumiR.idat(files, path, manifestfile=manifestfile, probeID="ProbeID")
expect_that(x, is_a("LumiBatch"))
expect_equivalent(dim(exprs(x)), c(90,2))
################################################################################
res <- featureNames(x)[1:10]
expected.res <- c("ILMN_1704173", "ILMN_1734742", "ILMN_1670130", "ILMN_2309245",
"ILMN_1809344", "ILMN_1793729", "ILMN_2385662", "ILMN_2205695",
"ILMN_1779257", "ILMN_1711453")
expect_equivalent(res, expected.res)
################################################################################
res <- controlData(x)$ProbeID[1:5]
expected.res <- c("ILMN_1343048", "ILMN_1343049", "ILMN_2038769", "ILMN_1343052", "ILMN_2038771")
expect_equivalent(res, expected.res)
})
test_that("probeID=ArrayAddressID", {
library(lumi)
options(width=80)
path <- system.file("extdata", package="lumidat")
files <- c("5356583020_A_Grn.idat", "5356583020_B_Grn.idat")
manifestfile <- system.file("extdata", "HumanHT-12_V3_0_R1_99999999.txt", package="lumidat")
x <- lumiR.idat(files, path, manifestfile=manifestfile, probeID="ArrayAddressID")
expect_that(x, is_a("LumiBatch"))
expect_equivalent(dim(exprs(x)), c(90,2))
################################################################################
res <- featureNames(x)[1:10]
expected.res <- c("4260551", "4760255", "6510553", "650553", "4250544", "870110",
"2100176", "1740731", "6420520", "6020544")
expect_equivalent(res, expected.res)
################################################################################
res <- controlData(x)$ProbeID[1:5]
expected.res <- c("5090180", "6510136", "1110170", "1450438", "2510500")
expect_equivalent(res, expected.res)
})
test_that("probeID=Sequence", {
library(lumi)
options(width=80)
path <- system.file("extdata", package="lumidat")
files <- c("5356583020_A_Grn.idat", "5356583020_B_Grn.idat")
manifestfile <- system.file("extdata", "HumanHT-12_V3_0_R1_99999999.txt", package="lumidat")
x <- lumiR.idat(files, path, manifestfile=manifestfile, probeID="Sequence")
expect_that(x, is_a("LumiBatch"))
expect_equivalent(dim(exprs(x)), c(90,2))
################################################################################
res <- featureNames(x)[1:10]
expected.res <- c("AGCTCACATGCAGTAGACTTGGGCAGGCAAAGGGGGCACCAAGGGCACAG", "CAGGCCTTCCCTGACCCAGCCAGGAACAAACAAGGGACCAAGTGCACACA",
"CCACACACTCACCACTCCCAGCTTCTCGTGTCCAGTGAAACCCCTGAACC", "AGGGGCGTTCTCCCAAAGATTAGGTCGTTTTCCAAAGAGCCGCGTCCCGG",
"TCACACAGCTAGGTCTTTTCAGAAGTGGTGGAAATTGGCAGCTGGGGTAC", "CTTGCCTAGAGAACACACATGGGCTTTGGAGCCCGACAGACCTGGGCTTG",
"GCTGAGAGAGAAAGAAGCAGCTCTTGAAGAAATGCGTAAGAAGATGCACC", "CCAGGCTGGTCTCAGAATTCTGGTGAGTGATCCTCCCACAGTGGACTTCC",
"CATGGATGCCAACCGGTCACCCAGGAGGATGGCAAAGAGAGTCGCATCTC", "GCCCACAAGGAGGACTTACAATGTGGAACTTAGTCTCTTTCCCTCACTCC")
expect_equivalent(res, expected.res)
################################################################################
res <- controlData(x)$ProbeID[1:5]
expected.res <- c(
"GAATAAAGAACAATCTGCTGATGATCCCTCCGTGGATCTGATTCGTGTAA", "CCATGTGATACGAGGGCGCGTAGTTTGCATTATCGTTTTTATCGTTTCAA",
"AATTAAAACGATGCACACAGGGTTTAGCGCGTACACGTATTGCATTATGC", "TCTGTCACTGTCAGGAAAGTGGTAAAACTGCAACTCAATTACTGCAATGC",
"GCCCCGTATTCAGTGTCGCTGATTTGTATTGTCTGAAGTTGTTTTTACGT")
expect_equivalent(res, expected.res)
})
test_that("probeID=NuID", {
library(lumi)
options(width=80)
path <- system.file("extdata", package="lumidat")
files <- c("5356583020_A_Grn.idat", "5356583020_B_Grn.idat")
manifestfile <- system.file("extdata", "HumanHT-12_V3_0_R1_99999999.txt", package="lumidat")
x <- lumiR.idat(files, path, manifestfile=manifestfile, probeID="NuID")
expect_that(x, is_a("LumiBatch"))
expect_equivalent(dim(exprs(x)), c(90,2))
################################################################################
res <- featureNames(x)[1:10]
expected.res <- c("lJ0Tksh_pKQKqRQqRI", "NSl9XhUlKBAQqFC5EQ", "iURHRR1Sfdu1LgFXgU",
"QKpvdUCPK2.1AiWbVo", "Q0RJyt.0guugPpJ6rE", "0flyIEROp.olYSF6n4",
"ZniIgIJJ34IDmwgjkU", "9Up63SD3ri411RLofU", "QTo5QWtFSijpAiLZN0",
"NlRCih8Q7oHy3f1dHU")
expect_equivalent(res, expected.res)
################################################################################
res <- controlData(x)$ProbeID[1:5]
expected.res <- c("0gwIEN5441dbo3j27A", "BU7jGKmbL_Tzb.zb9A", "9DwBjkRKvyZsRs_Tzk",
"o3tHtKAusAeQdDx5Dk", "ulWz0u2eP7Pt4L7.xs")
expect_equivalent(res, expected.res)
})
test_that("probeID=ERROR", {
library(lumi)
options(width=80)
path <- system.file("extdata", package="lumidat")
files <- c("5356583020_A_Grn.idat", "5356583020_B_Grn.idat")
manifestfile <- system.file("extdata", "HumanHT-12_V3_0_R1_99999999.txt", package="lumidat")
expect_error(x <- lumiR.idat(files, path, manifestfile=manifestfile, probeID="ERROR"))
})
################################################################################
################################################################################
# collapseMode=c("none", "max", "median", "mean"),
test_that("collapseMode=none aka backgroundCorrect=FALSE", {
library(lumi)
options(width=80)
path <- system.file("extdata", package="lumidat")
files <- c("5356583020_A_Grn.idat", "5356583020_B_Grn.idat")
manifestfile <- system.file("extdata", "HumanHT-12_V3_0_R1_99999999.txt", package="lumidat")
x <- lumiR.idat(files, path, manifestfile=manifestfile, probeID="ProbeID", collapseMode="none")
expect_that(x, is_a("LumiBatch"))
expect_equivalent(dim(exprs(x)), c(90,2))
# these probes are from genes with >1 probes
probes <- c("ILMN_1744897", "ILMN_1801608", "ILMN_1711283", "ILMN_2296644",
"ILMN_1652609", "ILMN_1807467", "ILMN_1761911", "ILMN_2121316",
"ILMN_1810533", "ILMN_1659166", "ILMN_1679194", "ILMN_1755897")
x <- x[probes, ]
# > data.frame(as(featureData(x), "data.frame"),exprs(x), check.names=FALSE)
# ProbeID TargetID 5356583020_A 5356583020_B
# ILMN_1744897 ILMN_1744897 KCNN3 52.41120 60.19562
# ILMN_1801608 ILMN_1801608 KCNN3 69.06544 73.10770
# ILMN_1711283 ILMN_1711283 PCDHGA9 67.22208 51.06295
# ILMN_2296644 ILMN_2296644 PCDHGA9 58.62053 65.66985
# ILMN_1652609 ILMN_1652609 RGNEF 112.96380 82.18444
# ILMN_1807467 ILMN_1807467 RGNEF 57.53606 73.94498
# ILMN_1761911 ILMN_1761911 SCYL1BP1 187.19250 227.17070
# ILMN_2121316 ILMN_2121316 SCYL1BP1 142.36550 138.79320
# ILMN_1810533 ILMN_1810533 SLC6A15 76.14130 66.54485
# ILMN_1659166 ILMN_1659166 SLC6A15 58.84699 55.11340
# ILMN_1679194 ILMN_1679194 UGT2B7 58.90470 66.43938
# ILMN_1755897 ILMN_1755897 UGT2B7 62.35626 67.29924
################################################################################
res <- exprs(x)[1:6,]
expected.res <- structure(c(52.4112, 69.06544, 67.22208, 58.62053, 112.9638,
57.53606, 60.19562, 73.1077, 51.06295, 65.66985, 82.18444, 73.94498
), .Dim = c(6L, 2L), .Dimnames = list(c("ILMN_1744897", "ILMN_1801608",
"ILMN_1711283", "ILMN_2296644", "ILMN_1652609", "ILMN_1807467"
), c("5356583020_A", "5356583020_B")))
expect_equivalent(res, expected.res)
################################################################################
res <- controlData(x)[1:6,]
expected.res <- structure(list(controlType = c("biotin", "biotin", "cy3_hyb",
"cy3_hyb", "cy3_hyb", "cy3_hyb"), ProbeID = c("ILMN_1343048",
"ILMN_1343049", "ILMN_2038769", "ILMN_1343052", "ILMN_2038771",
"ILMN_2038770"), `5356583020_A` = c(16902.39, 20562.41, 17585.26,
410.2783, 3419.561, 15378.33), `5356583020_B` = c(16668.27, 20507.38,
15846.65, 407.3946, 3164.278, 15831.14)), .Names = c("controlType",
"ProbeID", "5356583020_A", "5356583020_B"), row.names = c("1",
"2", "3", "4", "5", "6"), class = "data.frame")
expect_equivalent(res, expected.res)
})
test_that("collapseMode=max", {
library(lumi)
options(width=80)
path <- system.file("extdata", package="lumidat")
files <- c("5356583020_A_Grn.idat", "5356583020_B_Grn.idat")
manifestfile <- system.file("extdata", "HumanHT-12_V3_0_R1_99999999.txt", package="lumidat")
expect_message(
x <- lumiR.idat(files, path, manifestfile=manifestfile, probeID="ProbeID", collapseMode="max"),
"addControlData2lumi can't handle data that's been collapsed. forcing controls=FALSE"
)
expect_that(x, is_a("LumiBatch"))
expect_equivalent(dim(exprs(x)), c(82,2))
# subset to the genes which have >1 probes
x <- x[c("KCNN3", "NOMO1", "PCDHGA9", "RGNEF", "SCYL1BP1", "SLC6A15", "UGT2B7"), ]
# here's the data from collapseMode=none; i'll choose the right probe & double check below
# > data.frame(as(featureData(x), "data.frame"),exprs(x), check.names=FALSE)
# ProbeID TargetID 5356583020_A
# ILMN_1744897 ILMN_1744897 KCNN3 52.41120
# ILMN_1801608 ILMN_1801608 KCNN3 69.06544 <<<<
# ILMN_1711283 ILMN_1711283 PCDHGA9 67.22208 <<<<
# ILMN_2296644 ILMN_2296644 PCDHGA9 58.62053
# ILMN_1652609 ILMN_1652609 RGNEF 112.96380 <<<<
# ILMN_1807467 ILMN_1807467 RGNEF 57.53606
# ILMN_1761911 ILMN_1761911 SCYL1BP1 187.19250 <<<<
# ILMN_2121316 ILMN_2121316 SCYL1BP1 142.36550
# ILMN_1810533 ILMN_1810533 SLC6A15 76.14130 <<<<
# ILMN_1659166 ILMN_1659166 SLC6A15 58.84699
# ILMN_1679194 ILMN_1679194 UGT2B7 58.90470
# ILMN_1755897 ILMN_1755897 UGT2B7 62.35626 <<<<
################################################################################
res <- exprs(x)
expected.res <- structure(c(69.06544, 402.4396, 67.22208, 112.9638, 187.1925,
76.1413, 62.35626, 73.1077, 251.4016, 65.66985, 82.18444, 227.1707,
66.54485, 67.29924), .Dim = c(7L, 2L), .Dimnames = list(c("KCNN3",
"NOMO1", "PCDHGA9", "RGNEF", "SCYL1BP1", "SLC6A15", "UGT2B7"),
c("5356583020_A", "5356583020_B")))
# 5356583020_A 5356583020_B
# KCNN3 69.06544 73.10770
# NOMO1 402.43960 251.40160
# PCDHGA9 67.22208 65.66985
# RGNEF 112.96380 82.18444
# SCYL1BP1 187.19250 227.17070
# SLC6A15 76.14130 66.54485
# UGT2B7 62.35626 67.29924
expect_equivalent(res, expected.res)
# ^^^^ agrees with my manual assessment
################################################################################
res <- detection(x)
expected.res <- structure(c(0.0933333, 0, 0.1066667, 0, 0, 0.0266666, 0.1866667,
0.0266666, 0, 0.0933333, 0, 0, 0.0933333, 0.0933333), .Dim = c(7L,
2L), .Dimnames = list(c("KCNN3", "NOMO1", "PCDHGA9", "RGNEF",
"SCYL1BP1", "SLC6A15", "UGT2B7"), c("5356583020_A", "5356583020_B"
)))
# 5356583020_A 5356583020_B
# KCNN3 0.0933333 0.0266666
# NOMO1 0.0000000 0.0000000
# PCDHGA9 0.1066667 0.0933333
# RGNEF 0.0000000 0.0000000
# SCYL1BP1 0.0000000 0.0000000
# SLC6A15 0.0266666 0.0933333
# UGT2B7 0.1866667 0.0933333
expect_equivalent(res, expected.res)
})
test_that("collapseMode=median", {
library(lumi)
options(width=80)
path <- system.file("extdata", package="lumidat")
files <- c("5356583020_A_Grn.idat", "5356583020_B_Grn.idat")
manifestfile <- system.file("extdata", "HumanHT-12_V3_0_R1_99999999.txt", package="lumidat")
expect_message(
x <- lumiR.idat(files, path, manifestfile=manifestfile, probeID="ProbeID", collapseMode="median"),
"addControlData2lumi can't handle data that's been collapsed. forcing controls=FALSE"
)
expect_that(x, is_a("LumiBatch"))
expect_equivalent(dim(exprs(x)), c(82,2))
# subset to the genes which have >1 probes
x <- x[c("KCNN3", "NOMO1", "PCDHGA9", "RGNEF", "SCYL1BP1", "SLC6A15", "UGT2B7"), ]
# here's the data from collapseMode=none; i'll choose the right probe & double check below
# > data.frame(as(featureData(x), "data.frame"),exprs(x), check.names=FALSE)
# ProbeID TargetID 5356583020_A
# ILMN_1744897 ILMN_1744897 KCNN3 52.41120
# ILMN_1801608 ILMN_1801608 KCNN3 69.06544
# ILMN_1711283 ILMN_1711283 PCDHGA9 67.22208
# ILMN_2296644 ILMN_2296644 PCDHGA9 58.62053
# ILMN_1652609 ILMN_1652609 RGNEF 112.96380
# ILMN_1807467 ILMN_1807467 RGNEF 57.53606
# ILMN_1761911 ILMN_1761911 SCYL1BP1 187.19250
# ILMN_2121316 ILMN_2121316 SCYL1BP1 142.36550
# ILMN_1810533 ILMN_1810533 SLC6A15 76.14130
# ILMN_1659166 ILMN_1659166 SLC6A15 58.84699
# ILMN_1679194 ILMN_1679194 UGT2B7 58.90470
# ILMN_1755897 ILMN_1755897 UGT2B7 62.35626
################################################################################
res <- exprs(x)
expected.res <- structure(c(60.73832, 381.8736, 62.9213, 85.24995, 164.779, 67.49415,
60.63048, 66.65166, 224.6189, 58.3664, 78.06471, 182.982, 60.82912,
66.86931), .Dim = c(7L, 2L), .Dimnames = list(c("KCNN3", "NOMO1",
"PCDHGA9", "RGNEF", "SCYL1BP1", "SLC6A15", "UGT2B7"), c("5356583020_A",
"5356583020_B")))
# 5356583020_A 5356583020_B
# KCNN3 60.73832 66.65166
# NOMO1 381.87360 224.61890
# PCDHGA9 62.92130 58.36640
# RGNEF 85.24995 78.06471
# SCYL1BP1 164.77900 182.98200
# SLC6A15 67.49415 60.82912
# UGT2B7 60.63048 66.86931
expect_equivalent(res, expected.res)
## ah ok, collapseMode=median reverts to the 'arithmetic mean' of the middle 2 elements.
################################################################################
## same as for collapseMode=max... is that right??
res <- detection(x)
expected.res <- structure(c(0.0933333, 0, 0.1066667, 0, 0, 0.0266666, 0.1866667,
0.0266666, 0, 0.0933333, 0, 0, 0.0933333, 0.0933333), .Dim = c(7L,
2L), .Dimnames = list(c("KCNN3", "NOMO1", "PCDHGA9", "RGNEF",
"SCYL1BP1", "SLC6A15", "UGT2B7"), c("5356583020_A", "5356583020_B"
)))
# 5356583020_A 5356583020_B
# KCNN3 0.0933333 0.0266666
# NOMO1 0.0000000 0.0000000
# PCDHGA9 0.1066667 0.0933333
# RGNEF 0.0000000 0.0000000
# SCYL1BP1 0.0000000 0.0000000
# SLC6A15 0.0266666 0.0933333
# UGT2B7 0.1866667 0.0933333
expect_equivalent(res, expected.res)
})
test_that("collapseMode=mean", {
library(lumi)
options(width=80)
path <- system.file("extdata", package="lumidat")
files <- c("5356583020_A_Grn.idat", "5356583020_B_Grn.idat")
manifestfile <- system.file("extdata", "HumanHT-12_V3_0_R1_99999999.txt", package="lumidat")
expect_message(
x <- lumiR.idat(files, path, manifestfile=manifestfile, probeID="ProbeID", collapseMode="mean"),
"addControlData2lumi can't handle data that's been collapsed. forcing controls=FALSE"
)
expect_that(x, is_a("LumiBatch"))
expect_equivalent(dim(exprs(x)), c(82,2))
# subset to the genes which have >1 probes
x <- x[c("KCNN3", "NOMO1", "PCDHGA9", "RGNEF", "SCYL1BP1", "SLC6A15", "UGT2B7"), ]
################################################################################
res <- exprs(x)
expected.res <- structure(c(60.73832, 286.5653, 62.9213, 85.24995, 164.779, 67.49415,
60.63048, 66.65166, 182.4367, 58.3664, 78.06471, 182.982, 60.82912,
66.86931), .Dim = c(7L, 2L), .Dimnames = list(c("KCNN3", "NOMO1",
"PCDHGA9", "RGNEF", "SCYL1BP1", "SLC6A15", "UGT2B7"), c("5356583020_A",
"5356583020_B")))
# 5356583020_A 5356583020_B
# KCNN3 60.73832 66.65166
# NOMO1 286.56530 182.43670
# PCDHGA9 62.92130 58.36640
# RGNEF 85.24995 78.06471
# SCYL1BP1 164.77900 182.98200
# SLC6A15 67.49415 60.82912
# UGT2B7 60.63048 66.86931
expect_equivalent(res, expected.res)
################################################################################
## same as for collapseMode=max... is that right??
res <- detection(x)
expected.res <- structure(c(0.4333333, 0.00888889999999998, 0.2666667, 0.2333333,
0, 0.2133333, 0.2933333, 0.12, 0.00888889999999998, 0.42, 0.0133333,
0, 0.3, 0.0933333), .Dim = c(7L, 2L), .Dimnames = list(c("KCNN3",
"NOMO1", "PCDHGA9", "RGNEF", "SCYL1BP1", "SLC6A15", "UGT2B7"),
c("5356583020_A", "5356583020_B")))
# 5356583020_A 5356583020_B
# KCNN3 0.4333333 0.1200000
# NOMO1 0.0088889 0.0088889
# PCDHGA9 0.2666667 0.4200000
# RGNEF 0.2333333 0.0133333
# SCYL1BP1 0.0000000 0.0000000
# SLC6A15 0.2133333 0.3000000
# UGT2B7 0.2933333 0.0933333
expect_equivalent(res, expected.res)
# this **is** different to collapseMode=mean, great.
})
################################################################################
################################################################################
test_that("backgroundCorrect=TRUE", {
library(lumi)
options(width=80)
path <- system.file("extdata", package="lumidat")
files <- c("5356583020_A_Grn.idat", "5356583020_B_Grn.idat")
manifestfile <- system.file("extdata", "HumanHT-12_V3_0_R1_99999999.txt", package="lumidat")
x <- lumiR.idat(files, path, manifestfile=manifestfile, probeID="ProbeID", backgroundCorrect=TRUE)
expect_that(x, is_a("LumiBatch"))
expect_equivalent(dim(exprs(x)), c(90,2))
################################################################################
res <- exprs(x)[1:6,]
expected.res <- structure(c(30.52452, 1113.839, 1028.59, 724.6708, 394.9726,
1315.341, 6.253441, 802.3579, 902.5901, 507.5767, 466.2357, 1211.94
), .Dim = c(6L, 2L), .Dimnames = list(c("ILMN_1704173", "ILMN_1734742",
"ILMN_1670130", "ILMN_2309245", "ILMN_1809344", "ILMN_1793729"
), c("5356583020_A", "5356583020_B")))
expect_equivalent(res, expected.res)
################################################################################
res <- controlData(x)[1:6,]
expected.res <- structure(list(controlType = c("biotin", "biotin", "cy3_hyb",
"cy3_hyb", "cy3_hyb", "cy3_hyb"), ProbeID = c("ILMN_1343048",
"ILMN_1343049", "ILMN_2038769", "ILMN_1343052", "ILMN_2038771",
"ILMN_2038770"), `5356583020_A` = c(16902.39, 20562.41, 17585.26,
410.2783, 3419.561, 15378.33), `5356583020_B` = c(16668.27, 20507.38,
15846.65, 407.3946, 3164.278, 15831.14)), .Names = c("controlType",
"ProbeID", "5356583020_A", "5356583020_B"), row.names = c("1",
"2", "3", "4", "5", "6"), class = "data.frame")
expect_equivalent(res, expected.res)
})
################################################################################
################################################################################
# forbidden params: c("convertNuID", "lib.mapping", "dec", "inputAnnotation", "annotationColumn"),
test_that("forbidden parameters throw errors", {
library(lumi)
options(width=80)
path <- system.file("extdata", package="lumidat")
files <- c("5356583020_A_Grn.idat", "5356583020_B_Grn.idat")
manifestfile <- system.file("extdata", "HumanHT-12_V3_0_R1_99999999.txt", package="lumidat")
################################################################################
expect_error(x <- lumiR.idat(files, path, manifestfile=manifestfile, convertNuID=TRUE))
expect_error(x <- lumiR.idat(files, path, manifestfile=manifestfile, lib.mapping="garbage"))
expect_error(x <- lumiR.idat(files, path, manifestfile=manifestfile, dec="."))
expect_error(x <- lumiR.idat(files, path, manifestfile=manifestfile, inputAnnotation="garbage"))
expect_error(x <- lumiR.idat(files, path, manifestfile=manifestfile, annotationColumn="garbage"))
})
################################################################################
################################################################################
# # lumi::lumiR arguments:
# detectionTh=0.01, na.rm=TRUE, parseColumnName=FALSE, checkDupId=TRUE, QC=TRUE,
# columnNameGrepPattern=list(exprs='AVG_SIGNAL', se.exprs='BEAD_STD', detection='DETECTION', beadNum='Avg_NBEADS'),
## this seem to match the A or B from within the array barcodes, eg 5356583020_A_AVG_SIGNAL
test_that("parseColumnName=TRUE", {
library(lumi)
options(width=80)
path <- system.file("extdata", package="lumidat")
files <- c("5356583020_A_Grn.idat", "5356583020_B_Grn.idat")
manifestfile <- system.file("extdata", "HumanHT-12_V3_0_R1_99999999.txt", package="lumidat")
x <- lumiR.idat(files, path, manifestfile=manifestfile, parseColumnName=TRUE)
res <- sampleNames(x)
expected.res <- c("A", "B")
expect_equivalent(res, expected.res)
})
# does nothing with these input files
test_that("checkDupId=TRUE", {
library(lumi)
options(width=80)
path <- system.file("extdata", package="lumidat")
files <- c("5356583020_A_Grn.idat", "5356583020_B_Grn.idat")
manifestfile <- system.file("extdata", "HumanHT-12_V3_0_R1_99999999.txt", package="lumidat")
x <- lumiR.idat(files, path, manifestfile=manifestfile, checkDupId=TRUE)
expect_that(x, is_a("LumiBatch"))
})
# boring too...
test_that("QC=FALSE", {
library(lumi)
options(width=80)
path <- system.file("extdata", package="lumidat")
files <- c("5356583020_A_Grn.idat", "5356583020_B_Grn.idat")
manifestfile <- system.file("extdata", "HumanHT-12_V3_0_R1_99999999.txt", package="lumidat")
x <- lumiR.idat(files, path, manifestfile=manifestfile, QC=FALSE)
expect_that(x, is_a("LumiBatch"))
})
# columnNameGrepPattern=list(exprs='AVG_SIGNAL', se.exprs='BEAD_STD', detection='DETECTION', beadNum='Avg_NBEADS')
test_that("columnNameGrepPattern=MIN_SIGNAL", {
library(lumi)
options(width=80)
path <- system.file("extdata", package="lumidat")
files <- c("5356583020_A_Grn.idat", "5356583020_B_Grn.idat")
manifestfile <- system.file("extdata", "HumanHT-12_V3_0_R1_99999999.txt", package="lumidat")
x <- lumiR.idat(files, path, manifestfile=manifestfile, columnNameGrepPattern=list(exprs='MIN_SIGNAL', se.exprs='BEAD_STD', detection='DETECTION', beadNum='Avg_NBEADS'))
expect_that(x, is_a("LumiBatch"))
res <- exprs(x)[1:6,]
expected.res <- structure(c(88.54737, 1171.861, 1086.613, 782.6937, 452.9955,
1373.364, 62.09662, 858.2011, 958.4333, 563.4199, 522.0789, 1267.783
), .Dim = c(6L, 2L), .Dimnames = list(c("ILMN_1704173", "ILMN_1734742",
"ILMN_1670130", "ILMN_2309245", "ILMN_1809344", "ILMN_1793729"
), c("5356583020_A", "5356583020_B")))
expect_equivalent(res, expected.res)
# @TODO deliberate error to make MJC consider:
# why are MIN_SIGNAL,MAX_Signal,AVG_SIGNAL all identical? is it just this test data??
expect_equivalent(TRUE, FALSE)
})
test_that("columnNameGrepPattern=MAX_Signal", {
library(lumi)
options(width=80)
path <- system.file("extdata", package="lumidat")
files <- c("5356583020_A_Grn.idat", "5356583020_B_Grn.idat")
manifestfile <- system.file("extdata", "HumanHT-12_V3_0_R1_99999999.txt", package="lumidat")
x <- lumiR.idat(files, path, manifestfile=manifestfile, columnNameGrepPattern=list(exprs='MAX_Signal', se.exprs='BEAD_STD', detection='DETECTION', beadNum='Avg_NBEADS'))
expect_that(x, is_a("LumiBatch"))
res <- exprs(x)[1:6,]
expected.res <- structure(c(88.54737, 1171.861, 1086.613, 782.6937, 452.9955,
1373.364, 62.09662, 858.2011, 958.4333, 563.4199, 522.0789, 1267.783
), .Dim = c(6L, 2L), .Dimnames = list(c("ILMN_1704173", "ILMN_1734742",
"ILMN_1670130", "ILMN_2309245", "ILMN_1809344", "ILMN_1793729"
), c("5356583020_A", "5356583020_B")))
expect_equivalent(res, expected.res)
# @TODO deliberate error to make MJC consider:
# why are MIN_SIGNAL,MAX_Signal,AVG_SIGNAL all identical? is it just this test data??
expect_equivalent(TRUE, FALSE)
})
# # dropping the final terms in columnNameGrepPattern don't have an effet, at least on detection(), se.exprs(),
# # so default values must be enforced
# test_that("columnNameGrepPattern simple, exprs only", {
# library(lumi)
# options(width=80)
#
# path <- system.file("extdata", package="lumidat")
# files <- c("5356583020_A_Grn.idat", "5356583020_B_Grn.idat")
# manifestfile <- system.file("extdata", "HumanHT-12_V3_0_R1_99999999.txt", package="lumidat")
#
# x <- lumiR.idat(files, path, manifestfile=manifestfile, columnNameGrepPattern=list(exprs='AVG_Signal'))
# expect_that(x, is_a("LumiBatch"))
# })
R Package Documentation
Browse R Packages
We want your feedback!
Note that we can't provide technical support on individual packages. You should contact the package authors for that.
Embedding an R snippet on your website
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.