prepareHomer: Prepare input files for HOMER motif enrichment analysis.

In fmicompbio/monaLisa: Binned Motif Enrichment Analysis and Visualization

Prepare input files for HOMER motif enrichment analysis.

Description

For each bin, write genomic coordinates for foreground and background regions into files for HOMER motif enrichment analysis.

Usage

prepareHomer(
  gr,
  b,
  genomedir,
  outdir,
  motifFile,
  homerfile = findHomer(),
  regionsize = "given",
  Ncpu = 2L,
  verbose = FALSE
)

Arguments

gr	A GRanges object (or an object that can be coerced to one) with the genomic regions to analyze.
b	A vector of the same length as gr that groups its elements into bins (typically a factor).
genomedir	Directory containing sequence files in Fasta format (one per chromosome).
outdir	A path specifying the folder into which the output files (two files per unique value of b) will be written.
motifFile	A file with HOMER formatted PWMs to be used in the enrichment analysis.
homerfile	Path and file name of the findMotifsGenome.pl HOMER script.
regionsize	The peak size to use in HOMER ("given" keeps the coordinate region, an integer value will keep only that many bases in the region center).
Ncpu	Number of parallel threads that HOMER can use.
verbose	A logical scalar. If TRUE, print progress messages.

Details

For each bin (unique value of b) this functions creates two files in outdir (outdir/bin_N_foreground.tab and outdir/bin_N_background.tab, where N is the number of the bin and foreground/background correspond to the ranges that are/are not within the current bin). The files are in the HOMER peak file format (see http://homer.ucsd.edu/homer/ngs/peakMotifs.html for details).

In addition, a shell script file is created containing the shell commands to run the HOMER motif enrichment analysis.

Value

The path and name of the script file to run the HOMER motif enrichment analysis.

Examples

# prepare genome directory (here: one dummy chromosome)
genomedir <- tempfile()
dir.create(genomedir)
writeLines(c(">chr1", "ATGCATGCATCGATCGATCGATCGTACGTA"),
           file.path(genomedir, "chr1.fa"))

# prepare motif file, regions and bins
motiffile <- tempfile()
dumpJaspar(filename = motiffile, pkg = "JASPAR2020",
           opts = list(ID = c("MA0006.1")))
gr <- GenomicRanges::GRanges("chr1", IRanges::IRanges(1:4, width = 4))
b <- bin(1:4, nElements = 2)

# create dummy file (should point to local Homer installation)
homerfile <- file.path(tempdir(), "findMotifsGenome.pl")
writeLines("dummy", homerfile)

# run prepareHomer
outdir <- tempfile()
prepareHomer(gr = gr, b = b, genomedir = genomedir,
             outdir = outdir, motifFile = motiffile,
             homerfile = homerfile, verbose = TRUE)
list.files(outdir)

# clean up example
unlink(c(genomedir, motiffile, homerfile, outdir))

fmicompbio/monaLisa documentation built on Nov. 2, 2024, 1:33 p.m.