Nothing
setwd(file.path(getwd(), "testdata"))
context("Test that getSeqsAcrossBSJs() function works correctly")
test_that("getSeqsAcrossBSJs() retrieves the correct sequences", {
gtf <- formatGTF(pathToGTF = "gencodeVM16.gtf")
# Create the backSplicedJunctions data frame
backSplicedJunctions <- getBackSplicedJunctions(gtf)
mergedBSJunctions <- mergeBSJunctions(backSplicedJunctions, gtf)
# Retrive the genomic features
annotatedBSJs <- annotateBSJs(mergedBSJunctions, gtf)
if (requireNamespace("BSgenome.Mmusculus.UCSC.mm10", quietly = TRUE)){
# Get BSgenome object
genome <- BSgenome::getBSgenome("BSgenome.Mmusculus.UCSC.mm10")
# retrieve target sequences
targets <- getSeqsAcrossBSJs(annotatedBSJs,
gtf,
genome)
# For positive strand
expect_equal(targets$bsj$id[11], "Arhgap5:+:chr12:52516079:52542636")
expect_equal(targets$bsj$length[11], 22)
# The back-spliced sequences should be the one reported below
expect_equal(targets$bsj$seq[11], "UGAAGACACAGAGGAAGAUGAU")
#For negative strand
expect_equal(targets$bsj$id[7], "Eps15l1:-:chr8:72380306:72367904")
expect_equal(targets$bsj$length[7], 22)
# The back-spliced sequences should be the one reported below
expect_equal(targets$bsj$seq[7], "AGAUGUCCAAGAUCUCAUCAUU")
}else{
cat(
"Missing package BSgenome.Mmusculus.UCSC.mm10.
Use BiocManager to install it."
)
}
})
Any scripts or data that you put into this service are public.
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.